AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -irpoE_mjan_opreg_100.orf -g0.314 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.314 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 MJ0677 69 ethylene-inducible protein #2 MJ0678 62 conserved hypothetical protein #3 MJ0679 39 transketolase'' #4 MJ0680 23 pentose-5-phosphate-3-epimerase #5 MJ0681 156 transketolase' Motif number 1 TTATTTTATTTATTTTATTT 2 1 0 TATTTTATTT 0.892879 -62 AGAATAATAATTTTATTTTATTTATTTTAT 2 13 0 TTTTATTTTA 0.960226 -50 ATAAAATTATTATTCTATTTTCAAATAAAC 2 27 1 TATTCTATTT 0.875111 -36 TCAAATAAACTTTTATTGTTGGGATT 2 47 1 TTTTATTGTT 0.948265 -16 ATAATTAATTTATTATTTTTGTTT 3 5 0 TATTATTTTT 0.992459 -35 ATAATAAATTAATTATTTTGGGTGAAAAAT 3 19 1 AATTATTTTG 0.862219 -21 AATTTTATTTTTTGGTGATTTA 4 3 1 TTTTATTTTT 0.989827 -21 ATTTACTATCTATTATTTTTAGGTGTAAGT 5 20 1 TATTATTTTT 0.992459 -137 TATGACTAACAATTATTTTAGCATAACATC 5 56 1 AATTATTTTA 0.879525 -101 ATTATGGATTTTTTGTTTTTGCTTTTTTTA 5 86 1 TTTTGTTTTT 0.957881 -71 TTGTTTTTGCTTTTTTTATTAATTCATTGA 5 98 1 TTTTTTTATT 0.774668 -59 TGAGTAATGATATTATTTTTTAAATCTTAA 5 125 1 TATTATTTTT 0.992459 -32 ********** Masking position 6 Map Score: 22.5891 Number of sites scoring better than the average of aligned sites = 1337 Number in coding regions = 907 Number in noncoding regions = 430 Number of orfs with sites within 600 bp upstream = 342 Fraction of orfs with sites within 600 bp upstream = 0.0549309 Motif number 2 TTGGAGACTATAATTTCATAACAAACTTTTA 1 26 1 TAATTCATAA 0.936305 -44 TTTATTTTATTTATTTTATTT 2 1 0 TTATTTATTT 0.810966 -62 ATAAATAAAATAAAATTATTATTCTATTTTC 2 18 1 TAAATTATTA 0.848018 -45 CCCAAAATAATTAATTTATTATTTTTGTTT 3 10 0 TTATTTATTA 0.935571 -30 GATGTTATGCTAAAATAATTGTTAGTCATAT 5 55 0 TAAATAATTG 0.874048 -102 TATTTTAGCATAACATCATTATGGATTTTTT 5 69 1 TAAATCATTA 0.985685 -88 GCTTTTTTTATTAATTCATTGAGTAATGATA 5 106 1 TTATTCATTG 0.968366 -51 ATTTAAAAAATAATATCATTACTCAATGAAT 5 119 0 TAAATCATTA 0.93318 -38 ATATTATTTTTTAAATCTTAAAAAGGTGAAA 5 134 1 TTAATCTTAA 0.766697 -23 *** ******* Masking position 6 Map Score: 9.83846 Number of sites scoring better than the average of aligned sites = 731 Number in coding regions = 588 Number in noncoding regions = 143 Number of orfs with sites within 600 bp upstream = 153 Fraction of orfs with sites within 600 bp upstream = 0.0245744 Motif number 3 ATTAAACATATATAGTTGGAG 1 2 1 TTAAACATAT 0.874144 -68 ATTATTCTATTTTCAAATAAACTTTTATTG 2 35 1 TTTCAAATAA 0.943812 -28 GATTTTTCACCCAAAATAATTAAT 3 26 0 TTTCACCCAA 0.958141 -14 TATTTAAAACTTACACCTAAAAATAATAGA 5 28 0 TTACACCTAA 0.969077 -129 TAGGTGTAAGTTTTAAATATGACTAACAAT 5 39 1 TTTTAAATAT 0.712086 -118 TAACAATTATTTTAGCATAACATCATTATG 5 62 1 TTTAGCATAA 0.860199 -95 AGTTTCACCTTTTTAAGATTTA 5 145 0 TTTCACCTTT 0.922254 -12 ********** Masking position 2 Map Score: 1.90114 Number of sites scoring better than the average of aligned sites = 715 Number in coding regions = 571 Number in noncoding regions = 144 Number of orfs with sites within 600 bp upstream = 159 Fraction of orfs with sites within 600 bp upstream = 0.0255381 Motif number 4 GTTTGTTATGAAATTATAGTCTCCAACTAT 1 22 0 AAATTATAGT 0.882905 -48 AATCATTGATAAAAGTTTGTTATGAAATTA 1 36 0 AAAAGTTTGT 0.956761 -34 AAACTTTTATCAATGATTATGGAGGGAGAG 1 48 1 CAATGATTAT 0.803086 -22 AAATAAAATAAAATTATTATTCTATTTTCA 2 20 1 AAATTATTAT 0.826129 -43 TCCCAACAATAAAAGTTTATTTGAAAATAG 2 41 0 AAAAGTTTAT 0.945187 -22 TTTCACCCAAAATAATTAATTTATTATTTT 3 16 0 AATAATTAAT 0.750294 -24 ACCTAAAAATAATAGATAGTAAATAGAGGA 5 14 0 AATAGATAGT 0.946665 -143 ATGCTAAAATAATTGTTAGTCATATTTAAA 5 50 0 AATTGTTAGT 0.921792 -107 TTTAAGATTTAAAAAATAATATCATTACTC 5 126 0 AAAAAATAAT 0.874239 -31 ********** Masking position 7 Map Score: 6.24895 Number of sites scoring better than the average of aligned sites = 1154 Number in coding regions = 971 Number in noncoding regions = 183 Number of orfs with sites within 600 bp upstream = 173 Fraction of orfs with sites within 600 bp upstream = 0.0277867 Motif number 5 AAATTATAGTCTCCAACTATATATGTTTAA 1 12 0 CTCCAACTAT 0.982391 -58 AACTCTCCCTCCATAATCATTGAT 1 56 0 CTCCCTCCAT 0.995584 -14 ACTTCCTCTATTTACTATCTA 5 2 1 CTTCCTCTAT 0.989938 -155 ********** Masking position 9 Map Score: 1.06585 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 23 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 ********** No masking Map Score: 7.55607e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.55607e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.55607e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0