AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_mpneu.txt -z/home/amcguire/genomes/mpneu.fna -iaraC_mpneu_opreg_100.orf -g0.400 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 araD 300 L-ribulose-5-phosphate 4-epimerase; similar to Swiss-Prot Accession Number P08203, from E. coli Motif number 1 GCCAAAGAGCACCCTGATTTTGTGATGTTATCG 1 64 0 ACCCTGATGT 0.995486 -237 TGGCTTCCGGACCCCAATTCTTAATTAAATGAT 1 93 1 ACCCCAATTA 0.968645 -208 GGGGACATTGACCCTAAGGATTTAGGTATTTGT 1 136 0 ACCCTAATTT 0.995585 -165 GGGTCAATGTCCCCTAAAACTGTTCTTACAAAT 1 155 1 CCCCTAATGT 0.99564 -146 TATTGAAATAACCCTAATAATGTGTAAGCTACT 1 225 1 ACCCTAATGT 0.99573 -76 ******* *** Masking position 7 Map Score: 5.96614 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 18 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 GCTATTAAAGAGTGTTTGTAATTTGTCCACC 1 24 0 AGGTTTGTAA 0.930458 -277 TAGAAATGAAAAGATTTGTAAGAACAGTTTT 1 170 0 AAATTTGTAA 0.984223 -131 AATAACCCTAATAATGTGTAAGCTACTGGAT 1 231 1 ATATGTGTAA 0.940894 -70 AAGCTACTGGATAATTTGCCATTAACAGTTG 1 250 1 ATATTTGCCA 0.967661 -51 ATTTGCCATTAACAGTTGTAAAGCTGGCAAC 1 263 1 AAAGTTGTAA 0.981031 -38 TGATTCTAAAAATAGTTGCCAGCTTTACAAC 1 277 0 AAAGTTGCCA 0.972637 -24 ** ******** Masking position 7 Map Score: 3.13026 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 73 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 CTCCGACCACCATGGTGGACAA 1 2 1 TCCGCCACCA 0.998611 -299 GTGTTTGTAATTTGTCCACCATGGTGGTCGG 1 13 0 TTTGCCACCA 0.98979 -288 CTCTTTGGCTTCCGGACCCCAATTCTTAATT 1 88 1 TCCGACCCCA 0.994128 -213 **** ****** Masking position 11 Map Score: 0.23734 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 4 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0