AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -imelR_mtub_opreg_100.orf -g0.656 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.656 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv0188 118 hypothetical protein Rv0188 Motif number 1 CCGCTGGTCCGGCGCCCAATTTTCGTTG 1 1 1 CCTCGCCCCA 0.999497 -118 CAAGATTACGCCCGTTTTCGGGATGCCAGCAACGAAAA 1 30 0 CCTCGAGCCA 0.998282 -89 CTCGCTGCCACCCATCCATCTGCTCCAAGATTACGCCC 1 55 0 CCTTGCCCAA 0.997567 -64 TGCAGCAAAACTTTTGGGCTCGCTGCCACCCATCCATC 1 73 0 CTTCGCGCCA 0.999257 -46 TTTGCAACCTTTCTGTTATGCAGCAAAACTTTTGGG 1 93 0 CTCTGCGCAA 0.991687 -26 ** * * ** **** Masking position 18 Map Score: 5.89396 Number of sites scoring better than the average of aligned sites = 1248 Number in coding regions = 1155 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 2 AACGAAAATTGGGCGCCGGACCAGCGG 1 1 0 GGGGCGCAGG 0.99951 -118 TTTCGTTGCTGGCATCCCGAAAACGGGCGTAATCTTG 1 31 1 GGCTCGAAGG 0.99307 -88 GGCGTAATCTTGGAGCAGATGGATGGGTGGCAGCGAG 1 56 1 TGGGCAGAGG 0.993374 -63 ATGGATGGGTGGCAGCGAGCCCAAAAGTTTTGCTGCA 1 74 1 GGCGCGCAAG 0.999242 -45 CCAAAAGTTTTGCTGCATAACAGAAAGGTTGCAAA 1 94 1 TGCGCACGAG 0.991529 -25 *** ** * * * ** Masking position 6 Map Score: 2.36271 Number of sites scoring better than the average of aligned sites = 3060 Number in coding regions = 2823 Number in noncoding regions = 237 Number of orfs with sites within 600 bp upstream = 223 Fraction of orfs with sites within 600 bp upstream = 0.0358175 Motif number 3 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0