AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -itorR_mtub_opreg_100.orf -g0.656 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.656 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 bisC 106 bisC Motif number 1 CGCTGCAGTCTAAAACCTGGT 1 2 1 GCTGCAGTCT 0.997498 -105 CGCAACGATGGCACCAGGTTTTAGACTGCA 1 14 0 GCACCAGGTT 0.994934 -93 CGGCAACCTAGCAGCTAGTTGAGCTCAGAA 1 71 0 GCAGCTAGTT 0.989394 -36 GCAGTCTAGTGCGGCAACCTAGCAGCTAGT 1 82 0 GCGGCAACCT 0.995483 -25 TTGCAGCAGTCTAGTGCGGCAA 1 95 0 GCAGCAGTCT 0.999008 -12 ********** Masking position 10 Map Score: 10.4689 Number of sites scoring better than the average of aligned sites = 1119 Number in coding regions = 1027 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 2 CCAGGTTTTAGACTGCAGCG 1 1 0 GACTGCAGCG 0.900626 -106 GCGTCGCAACGATGGCACCAGGTTTTAGAC 1 18 0 GATGGCACCA 0.992963 -89 CTAGCTGCTAGGTTGCCGCACTAGACTGCT 1 83 1 GGTTGCCGCA 0.918314 -24 TGCCGCACTAGACTGCTGCAA 1 96 1 GACTGCTGCA 0.98723 -11 ********** Masking position 5 Map Score: 6.49666 Number of sites scoring better than the average of aligned sites = 671 Number in coding regions = 618 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 3 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0