AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -icpxR9_pyro_opreg_300.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH0479_PH0480 31 PH0479: 277aa long hypothetical methyl-accepting chemotaxis protein, PH0480: 110aa long hypothetical protein #2 PH0481 263 280aa long hypothetical chemotaxis protein methyltransferase Motif number 1 CGTTGAAGACCTCGATAAGGAAATAAA 1 6 1 AAGCCTCATA 0.951514 -26 GAGCAAAATGAAGAGTTCATAAGTCTTCCTGG 2 12 0 AAGGTTCTAA 0.826127 -252 CTACCAATTATGACCTTCGTTAAAATATGTAA 2 45 1 TGACTTCTTA 0.952293 -219 AGAAGAGACGAAAACTTTTTTACATATTTTAA 2 64 0 AAACTTTTTA 0.854684 -200 GTAAAACTACTAGGCTTCATTAAAAGAAGAGA 2 88 0 TAGCTTCTTA 0.992199 -176 GTAGATTTTCTAAACTTCAAAAATGGAGATGT 2 118 0 TAACTTCAAA 0.943322 -146 ATACAATGATAAACCTTCCTTAATAAAAATAT 2 180 0 AAACTTCTTA 0.981357 -84 CATGATATTTTCGGCTTCTATACAATGATAAA 2 199 0 TCGCTTCATA 0.983221 -65 AATATCATGATCGTCTTAGATATGCAACAAAA 2 222 1 TCGCTTAATA 0.867437 -42 *** **** *** Masking position 7 Map Score: 7.57328 Number of sites scoring better than the average of aligned sites = 869 Number in coding regions = 812 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 2 TCGATAAGGAAATAAAGGAG 1 22 1 AATAAAGGAG 0.978964 -10 GTAGTGAGCAAAATGAAGAGTTCATAAGTC 2 19 0 AAATGAAGAG 0.978964 -245 AGGCTTCATTAAAAGAAGAGACGAAAACTT 2 79 0 AAAAGAAGAG 0.991567 -185 TCTAAACTTCAAAAATGGAGATGTAAAACT 2 112 0 AAAAATGGAG 0.978964 -152 ********** Masking position 2 Map Score: 2.88072 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 151 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AGATGTAAAACTACTAGGCTTCATTAAAAG 2 94 0 CTACTAGGCT 0.979516 -170 CTTTGTAGATTTTCTAAACTTCAAAAATGG 2 124 0 TTTCTAAACT 0.881843 -140 TTTAGAAAATCTACAAAGCTACCTACACAA 2 136 1 CTACAAAGCT 0.986692 -128 ACAAAGCTACCTACACAACTACGTGCATAA 2 148 1 CTACACAACT 0.986692 -116 AATCCACCCCTCAACTTGGATTTTGT 2 248 0 CCCCTCAACT 0.965603 -16 ********** Masking position 10 Map Score: 1.30133 Number of sites scoring better than the average of aligned sites = 292 Number in coding regions = 275 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 4 CTTCGTTAAAATATGTAAAAAAGTTTTCGT 2 59 1 ATATGTAAAA 0.986159 -205 TCAAAAATGGAGATGTAAAACTACTAGGCT 2 104 0 AGATGTAAAA 0.983671 -160 ATCGTCTTAGATATGCAACAAAATCCAAGT 2 231 1 ATATGCAACA 0.97706 -33 ********** Masking position 7 Map Score: 0.926525 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 18 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 TTAAAAGAAGAGACGAAAACTTTTTTACAT 2 71 0 AGACGAAAAC 0.990883 -193 ATTGTATAGAAGCCGAAAATATCATGATCG 2 205 1 AGCCGAAAAT 0.990883 -59 TGCATATCTAAGACGATCATGATATTTTCG 2 218 0 AGACGATCAT 0.984034 -46 ********** Masking position 6 Map Score: 0.577447 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0