AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -igalR_pyro_opreg_300.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH0365 54 327aa long hypothetical galactose-1-phosphate uridyltransferase #2 PH0369 92 350aa long hypothetical galactokinase #3 PH0378 56 318aa long hypothetical UDP-glucose 4-epimerase #4 PH1713 45 498aa long hypothetical sugar transport ATP-binding protein #5 PH1714 300 405aa long hypothetical protein #6 PH1742 55 306aa long hypothetical UDP-glucose 4-epimerase Motif number 1 AATTTTATTAAGTTTTTGACTATTATAGTCAAAAC 2 8 0 ATTTGAATAG 0.994719 -85 AACTTAATAAAATTTTCGACAATGTGAGTGAGCTTGAA 2 32 1 ATTTGAATAG 0.994719 -61 GAGCTTGAAGATTTTTAGACTCTACAACATTACTGATC 2 61 1 ATTTGACTAC 0.957768 -32 TTTAGGGCACTTAACGAGAATCAAAGACTTATATTG 5 9 1 ATTAGAATAG 0.967418 -292 CTTTAAACGTTTTTCTTGAGGATCTCAGTAGGAGGACA 5 72 1 TTTTGAATAG 0.967418 -229 ATGAGTCCTAACTCTTTAAGTATTCTAGCGTTGAGTTT 5 131 0 ATCTAAATAG 0.980739 -170 AAGAGTTAGGACTCATAGATTATGGTACCAGAGATAGG 5 153 1 ATCTGAATAC 0.987664 -148 TTGAGGAGGTAATCGTTAAATATCCCACGATTCTTTTT 5 256 1 ATCTAAATAC 0.963289 -45 TGGGGCCCCTAATTATTAAAAATTTGAGGCATTTAAAC 6 27 0 ATTTAAATAG 0.984059 -29 * ** * ** ** ** Masking position 9 Map Score: 12.0146 Number of sites scoring better than the average of aligned sites = 71 Number in coding regions = 61 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 AGTTCAAAGTATATTAAAGGTGGTCGTAA 1 4 0 ATTAAAGTTG 0.956188 -51 GAACTAAACAATTTTAAGGTTGGTGAGAGT 1 35 1 ATTAAGGTTA 0.976672 -20 AATGTGAGTGAGCTTGAAGATTTTTAGACTCTACAA 2 52 1 ATTGAAGTTA 0.973074 -41 AGACTCTACAACATTACTGATCTTTA 2 77 1 ATTACTGTTA 0.919462 -16 AACCCACTAGACCTTACAGTTATATAATTATGCCCA 3 20 0 ATTACAGTAA 0.938599 -37 TTAAAACACACCTTAAAGGTAGAAAAGGAAAAAGG 4 21 0 ATTAAAGTAA 0.933816 -25 TCAAAGACTTATATTGAGGAATATAAACGGAAATTA 5 31 1 ATTGAGGATA 0.904029 -270 ATATAAACGGAAATTACAGATCTTTAAACGTTTTTC 5 51 1 ATTACAGTTA 0.98214 -250 TCTTCAGTTAACTTTACAGGCTTTGGCCTATCTCTG 5 181 0 ATTACAGCTG 0.862643 -120 AATTATTAAAAATTTGAGGCATTTAAACGATTTCGG 6 19 0 ATTGAGGATA 0.904029 -37 * ****** * * * Masking position 5 Map Score: 7.80467 Number of sites scoring better than the average of aligned sites = 158 Number in coding regions = 139 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 TTTAGTTCAAAGTATATTAAAGGTGGTCGTAA 1 10 0 AGTATAAAGG 0.811095 -45 GTGAGCTTGAAGATTTTTAGACTCTACAACATT 2 59 1 AGATTAGACT 0.59801 -34 AAAAGGAAAAAGGAATAAAAACT 4 1 0 AGGTAAAACT 0.92643 -45 TTTAGGGCACTTAACGAGAATCAAAG 5 4 1 AGGATTAACG 0.971628 -297 ACTTATATTGAGGAATATAAACGGAAATTACAG 5 37 1 AGGTTAAACG 0.995155 -264 CGGAAATTACAGATCTTTAAACGTTTTTCTTGA 5 58 1 AGATTAAACG 0.982123 -243 GTTGAGTTTTAGTGTTGAAATCGGTTTGCTTGT 5 107 0 AGTTAAATCG 0.733889 -194 AAAGAATCGTGGGATATTTAACGATTACCTCCT 5 259 0 GGGATTAACG 0.888915 -42 TAAAAATTTGAGGCATTTAAACGATTTCGGGGA 6 16 0 AGGTTAAACG 0.994997 -40 *** * ****** Masking position 2 Map Score: 5.25671 Number of sites scoring better than the average of aligned sites = 254 Number in coding regions = 224 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 4 CTTAAAGGTAGAAAAGGAAAAAGGAATAAA 4 15 0 GAAAAGGAAA 0.868685 -31 AGGATCTCAGTAGGAGGACAAGCAAACCGA 5 90 1 TAGGAGGACA 0.958289 -211 AAAGTTAACTGAAGAGGGAAAGGTCATTCT 5 202 1 GAAGAGGGAA 0.976895 -99 GCTCCTGGAGGGGGATGAAATTTGAGGAGG 5 235 1 GGGGATGAAA 0.942257 -66 GATGAAATTTGAGGAGGTAATCGTTAAATA 5 248 1 GAGGAGGTAA 0.982706 -53 CTTTTTAAATTAGGTGGATACTA 5 288 1 TAGGTGGATA 0.850183 -13 AAACGATTTCGGGGAGGGTA 6 1 0 GGGGAGGGTA 0.982425 -55 ********** Masking position 10 Map Score: 3.81919 Number of sites scoring better than the average of aligned sites = 1123 Number in coding regions = 1037 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 90 Fraction of orfs with sites within 600 bp upstream = 0.0144555 Motif number 5 TACTTTGAACTAAACAATTTTAAGGTTGGT 1 29 1 TAAACAATTT 0.944379 -26 TACAGATCTTTAAACGTTTTTCTTGAGGAT 5 65 1 TAAACGTTTT 0.561812 -236 GAGGACAAGCAAACCGATTTCAACACTAAA 5 103 1 AAACCGATTT 0.820748 -198 CGTGGGATATTTAACGATTACCTCCTCAAA 5 255 0 TTAACGATTA 0.871196 -46 TTGAGGCATTTAAACGATTTCGGGGAGGGT 6 12 0 TAAACGATTT 0.845741 -44 ********** Masking position 3 Map Score: 3.04323 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 26 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 AATTTTAAGGTTGGTGAGAGT 1 44 1 TTGGTGAGAG 0.947066 -11 GTAAAGTTAACTGAAGAGGGAAAGGTCATT 5 200 1 CTGAAGAGGG 0.987481 -101 TCTCATGCTCCTGGAGGGGGATGAAATTTG 5 229 1 CTGGAGGGGG 0.987664 -72 GGGATGAAATTTGAGGAGGTAATCGTTAAA 5 246 1 TTGAGGAGGT 0.955868 -55 TTAAACGATTTCGGGGAGGGTA 6 3 0 TCGGGGAGGG 0.991359 -53 ********** Masking position 6 Map Score: 2.00805 Number of sites scoring better than the average of aligned sites = 278 Number in coding regions = 256 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 7 ********** No masking Map Score: 1.55852e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.55852e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.55852e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0