AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -ilexA_pyro_opreg_300.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH0120 50 211aa long hypothetical protein #2 PH0697 300 641aa long hypothetical protein #3 PH1932 188 192aa long hypothetical protein #4 PH1933 29 159aa long hypothetical protein Motif number 1 GTTATATCTCGAGAAAAATGTCTTGGAGGCTTAACCG 1 24 1 GAGAAATCTA 0.787401 -27 TATGAGTATTGGGAAGGTATTTGAGATGAAAGATAGA 2 12 0 GGGAGGTTAT 0.960421 -289 TACTCATATTGAGTAAGTCTTCAATCTTAGATCAGCA 2 41 1 GAGAAGTCAT 0.981114 -260 CATATTTAATGAGAAGGGCCTTTAGATAAAGCTGAAG 2 76 1 GAGAGGTTAT 0.991477 -225 TTTTCTTGCAGAGCAAAGGCTTCAGCTTTATCTAAAG 2 95 0 GAGAAATTAT 0.985367 -206 TTGACCTCCTGAGGAGAATTTCAACTTCTTCATAGTG 2 190 1 GAGAGATCAT 0.987032 -111 ATTACTATTCGACCAGAGATATTATATGGTGAGATAA 2 229 0 GACAGAATAT 0.794484 -72 GGCCCACTCGGAGAAAAGTTATGAAATTGAT 3 5 0 GAGAAAATAT 0.949292 -184 TTCTTTTACAGAGGAAAAAGTTATATTGGAAAAGCGT 3 119 1 GAGAAATTTT 0.949291 -70 AAAGAAGATGGAGGAGGGGGTTTAAAA 4 1 0 GAGAGGTTAA 0.97001 -29 *** *** ** * * Masking position 5 Map Score: 9.88758 Number of sites scoring better than the average of aligned sites = 594 Number in coding regions = 558 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 2 AAAATGTCTTGGAGGCTTAACCG 1 38 1 GGAGGCTAAC 0.972157 -13 ATTCTCCTCAGGAGGTCAAAAGACTATACAC 2 178 0 GGAGGTCAAA 0.972694 -123 TGCACTATGAAGAAGTTGAAATTCTCCTCAG 2 198 0 AGAAGTTAAA 0.84985 -103 AATTAAATTCCAAGGCTAAAAACCTACCGAT 2 264 0 CAAGGCTAAA 0.921766 -37 TATATTGGAAAAGCGTTAAAACATTTATCAG 3 140 1 AAGCGTTAAA 0.855387 -49 ACATTTATCAGAGCGTTAAAATTCTGGAGGC 3 160 1 GAGCGTTAAA 0.955914 -29 TTAAAATTCTGGAGGCTGAAAAGG 3 175 1 GGAGGCTAAA 0.99245 -14 AGATGGAGGAGGGGGTTTAAAA 4 2 0 GGGGGTTAAA 0.99245 -28 ******* *** Masking position 9 Map Score: 5.97017 Number of sites scoring better than the average of aligned sites = 479 Number in coding regions = 406 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 81 Fraction of orfs with sites within 600 bp upstream = 0.01301 Motif number 3 AGAAAAATGTCTTGGAGGCTTAACCG 1 35 1 CTTGGAGGCT 0.919766 -16 TTCAGCTTTATCTAAAGGCCCTTCTCATTA 2 82 0 TCTAAAGGCC 0.821265 -219 TTTAGATAAAGCTGAAGCCTTTGCTCTGCA 2 96 1 GCTGAAGCCT 0.961645 -205 GAAATTCTCCTCAGGAGGTCAAAAGACTAT 2 182 0 TCAGGAGGTC 0.912937 -119 TCCGAGTGGGCCCGTAGCCTAGCAGGATAG 3 30 1 CCCGTAGCCT 0.921799 -159 GGCTTAGAAGGCCGGCGCCCTATCCTGCTA 3 49 0 GCCGGCGCCC 0.979059 -140 GGCCTTCTAAGCCGGAGGTCGCGGGTTCGA 3 66 1 GCCGGAGGTC 0.984959 -123 GCGTTAAAATTCTGGAGGCTGAAAAGG 3 172 1 TCTGGAGGCT 0.989594 -17 ********** Masking position 7 Map Score: 3.70615 Number of sites scoring better than the average of aligned sites = 433 Number in coding regions = 370 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 4 GAGATATAACTTAAAAGTTGTGG 1 4 0 TTAAAAGTTG 0.860289 -47 AGGGCCTTTAGATAAAGCTGAAGCCTTTGC 2 90 1 GATAAAGCTG 0.921954 -211 TACACATCTTGCAAACGTTGCTTTTAAAGA 2 153 0 GCAAACGTTG 0.979963 -148 AATGCACTATGAAGAAGTTGAAATTCTCCT 2 201 0 GAAGAAGTTG 0.979542 -100 CTCTGTAAAAGAAAACGTTGGCGGGCCCGG 3 102 0 GAAAACGTTG 0.990872 -87 TTTTACAGAGGAAAAAGTTATATTGGAAAA 3 122 1 GAAAAAGTTA 0.952957 -67 ********** Masking position 5 Map Score: 4.78279 Number of sites scoring better than the average of aligned sites = 313 Number in coding regions = 293 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 CTTTTCTCCGAGTGGGCCCGTAGCCTAGCA 3 24 1 AGTGGGCCCG 0.990041 -165 CGGCTTAGAAGGCCGGCGCCCTATCCTGCT 3 50 0 GGCCGGCGCC 0.962297 -139 AGCCGGAGGTCGCGGGTTCGAATCCCGCCG 3 75 1 CGCGGGTTCG 0.980155 -114 AGAAAACGTTGGCGGGCCCGGCGGGATTCG 3 93 0 GGCGGGCCCG 0.984448 -96 ********** Masking position 5 Map Score: 0.835447 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 10 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 6 TAGCAATTTTTCTTGCAGAGCAAAGGCTTC 2 109 0 TCTTGCAGAG 0.974946 -192 TTCTCTCGGAGTTTTTAATTA 2 290 0 TCTCTCGGAG 0.983664 -11 TTTCATAACTTTTCTCCGAGTGGGCCCGTA 3 16 1 TTTCTCCGAG 0.982388 -173 CAACGTTTTCTTTTACAGAGGAAAAAGTTA 3 112 1 TTTTACAGAG 0.960517 -77 CGTTAAAACATTTATCAGAGCGTTAAAATT 3 153 1 TTTATCAGAG 0.972116 -36 ********** Masking position 3 Map Score: 2.86092 Number of sites scoring better than the average of aligned sites = 46 Number in coding regions = 39 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 7 ********** No masking Map Score: 1.81432e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.81432e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.81432e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0