AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -imalT_pyro_opreg_100.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH0024 36 284aa long hypothetical sugar transport membrane protein #2 PH0025 169 426aa long hypothetical protein #3 PH0194 60 375aa long hypothetical multiple sugar-binding transport ATP-binding protein #4 PH0206 132 544aa long hypothetical protein #5 PH1337 300 197aa long hypothetical protein #6 PH1338 26 202aa long hypothetical protein #7 PH1340 58 120aa long hypothetical protein Motif number 1 CCCAGATAAAAAAGAAATAGAGAAA 1 3 0 AAGAAAGAGA 0.98931 -34 TTTTGTTTTCAAAGGCAAAAACAGAAAAATAAA 2 108 1 AAGGAAAACA 0.967361 -62 AAAAACAGAAAAATAAATAAAGATTTAGGGCAT 2 124 1 AATAAAAAGA 0.85658 -46 ATTGCATGAGAAGACTAAAAACATTTCCTGGAA 3 21 0 AAACAAAACA 0.740968 -40 CGAGGTTTTAAAGGCTAAGGAGATATTCGATGC 5 24 1 AAGCAGGAGA 0.954201 -277 TTACGAGAGTAAAAGCATAGAGAATATCGTGAT 5 162 1 AAAGAAGAGA 0.981868 -139 ATATCGTGATAACTGCAAAGAGATATGCGAGAG 5 185 1 AATGAAGAGA 0.981868 -116 TTATGAAAGCAAAGGAAGAGGGAGAAATGAAAA 5 221 1 AAGGAAGGGA 0.980149 -80 AAGAGGGAGAAATGAAAAAGAGAGAATTACTTA 5 236 1 AAGAAAGAGA 0.98931 -65 AAGGGGACAGACATCCATAGAAG 7 1 1 AAGGAAGACA 0.99057 -58 ** ** * ***** Masking position 7 Map Score: 12.04 Number of sites scoring better than the average of aligned sites = 448 Number in coding regions = 420 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 2 GGTTAGATATTAATTTCTCTCAGAATAGGTA 4 23 0 TATTTCTCTC 0.965336 -110 TTAGTGCATCGAATATCTCCTTAGCCTTTAA 5 31 0 GATATCTCCT 0.97717 -270 TAATCCTTTGGGATAGCTCACTTAGTGCATC 5 52 0 GATAGCTCAC 0.915645 -249 AGAATCCCCTGAATATCTGCTTTCCCCTAAT 5 79 0 GATATCTGCT 0.919649 -222 AAATTCTCTCGCATATCTCTTTGCAGTTATC 5 192 0 GATATCTCTT 0.981094 -109 TTTGCTTTCATAAATTCTCTCGCATATCTCT 5 203 0 TAATTCTCTC 0.8856 -98 TCTCTCTTTTTCATTTCTCCCTCTTCCTTTG 5 230 0 TATTTCTCCC 0.958282 -71 AAACCTTTAAGTAATTCTCTCTTTTTCATTT 5 245 0 GAATTCTCTC 0.964832 -56 GCTCTTCTATGGATGTCTGTCCCCTT 7 6 0 GATGTCTGTC 0.922407 -53 TTATCAGAATGAATAGCTCTTCTATGGATGT 7 21 0 GATAGCTCTT 0.957105 -38 * ********* Masking position 8 Map Score: 9.87967 Number of sites scoring better than the average of aligned sites = 428 Number in coding regions = 399 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 AATAAATAAAGATTTAGGGCATAAGGGATCTT 2 135 1 GATTAGGGAT 0.989149 -35 CAATGTAAGTTATTCGGGGTATTTAAAAAGTG 4 58 0 TATTGGGGAT 0.982465 -75 TATCCCAAAGGATTAGGGGAAAGCAGATATTC 5 68 1 GATTGGGGAA 0.977085 -233 GGAAAGCAGATATTCAGGGGATTCTACCCCGA 5 85 1 TATTAGGGAT 0.96134 -216 TTGTCACGTTGCTTAGCGGAATTTACGAGAGT 5 140 1 GCTTGCGGAT 0.963855 -161 AGGTTTACCAGATTTTGAGGATATATATCCCG 5 270 1 GATTTGAGAT 0.96134 -31 CAGCTAATATGATTATCAGAATGAATAGCTCT 7 32 0 GATTTCAGAT 0.912989 -27 **** **** ** Masking position 11 Map Score: 5.12435 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 127 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 TTTCTCTATTTCTTTTTTATCTGGGAGGGCGT 1 10 1 TCTTTTTACT 0.90723 -27 TTTAGGAAGATACATTTTTAATTGGTAAATTTA 2 19 0 TCATTTTATT 0.965163 -151 AATTCAAATCTATTATGTTAGCTTTGTTATCTG 2 51 1 TTTATTTACT 0.782008 -119 GTTATCTGTTTTTAATGTAAATTAGGCATTAGT 2 76 1 TTAATTAATT 0.788203 -94 AGTCTTCTCATGCAATTTTATTTTTAAGAAGAG 3 38 1 TCAATTTATT 0.977995 -23 AATTGAAAAGTCCAATGTAAGTTATTCGGGGTA 4 69 0 TCAATTAATT 0.942098 -64 CATTGGACTTTTCAATTTTAGTGTACTTTCTTA 4 85 1 TCAATTTATG 0.921904 -48 AATTTTAGTGTACTTTCTTAATTCGTCCTCTAA 4 98 1 TCTTTTTATT 0.94526 -35 * **** *** ** Masking position 10 Map Score: 2.63212 Number of sites scoring better than the average of aligned sites = 146 Number in coding regions = 117 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 5 CATTAGTTTTGTTTTCAAAGGCAAAAACAGA 2 102 1 GTTTTCAAGG 0.906263 -68 AGCAATGTTTTTCCAGGAAATGTTTTT 3 7 1 GTTTTTCAGG 0.987383 -54 TCCAATGTAAGTTATTCGGGGTATTTAAAAA 4 61 0 GTTATTCGGG 0.98482 -72 GGCCTCCCGAGGTTTTAAAGGCTAAGGAGAT 5 17 1 GGTTTTAAGG 0.939429 -284 AGGCTAAGGAGATATTCGATGCACTAAGTGA 5 35 1 GATATTCATG 0.894166 -266 GGGGAAAGCAGATATTCAGGGGATTCTACCC 5 83 1 GATATTCGGG 0.978391 -218 ******* *** Masking position 5 Map Score: 1.73018 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 144 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 CCTCCCAGATAAAAAAGAAATAGAGAAA 1 8 0 AAAAAGAAAT 0.945445 -29 ATTTACATTAAAAACAGATAACAAAGCTAAC 2 67 0 AAAAAGATAA 0.955258 -103 TTCAAAGGCAAAAACAGAAAAATAAATAAAG 2 115 1 AAAAAGAAAA 0.985964 -55 GAATAGGTAAAATAATGAAAA 4 1 0 AATATGAAAA 0.902802 -132 AAAGTACACTAAAATTGAAAAGTCCAATGTA 4 83 0 AAAATGAAAA 0.974126 -50 GGAGAAATGAAAAAGAGAGAATTACTTAAAG 5 241 1 AAAAAGAGAA 0.969367 -60 **** ****** Masking position 4 Map Score: 5.45049 Number of sites scoring better than the average of aligned sites = 99 Number in coding regions = 78 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 7 TAATAGATTTGAATTTTAGGAAGATACATT 2 36 0 GAATTTTAGG 0.907724 -134 AAATAAATAAAGATTTAGGGCATAAGGGAT 2 134 1 AGATTTAGGG 0.93977 -36 AGGGCATAAGGGATCTTTGGTGAACCATCC 2 150 1 GGATCTTTGG 0.960215 -20 CTATCCCAAAGGATTAGGGGAAAGCAGATA 5 67 1 GGATTAGGGG 0.944085 -234 AAGGTTTACCAGATTTTGAGGATATATATC 5 269 1 AGATTTTGAG 0.888164 -32 TAGGGGAATCTTGGGTATGAATATA 6 12 0 GAATCTTGGG 0.977043 -15 ********** Masking position 4 Map Score: 0.0359148 Number of sites scoring better than the average of aligned sites = 299 Number in coding regions = 274 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 8 ********** No masking Map Score: -1.2126e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.2126e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.2126e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0