AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -ioxyR_pyro_opreg_300.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH1477 239 142aa long hypothetical protein Motif number 1 AATTATGGCATATCTTCATGGGATCAACTGG 1 6 1 TGGATACTGG 0.995129 -234 TGGGATCAACTGGAAGAAAATAAGGGATACATTGAA 1 29 1 TGGAGAAGGG 0.995919 -211 AAGGGATACATTGAAGATAGTTGGGGCTCCAACGAC 1 50 1 TTGAGAAGGG 0.985199 -190 CTTACGAACTAGGTATAGATCCCGAGATTATAATAG 1 88 1 AGGATAAGAG 0.987076 -152 CCTAATTGTATGGGCTATCGTTAGAGCTTCTATTAT 1 117 0 TGGCTACGAG 0.991117 -123 TTACCCAGGATTGTATATCTCTCTGGCCTAATTGTA 1 143 0 TTGATACTGG 0.982368 -97 TGGGTAAGGAAGGCATAACTAGAGAGGCCGCTGAAA 1 172 1 AGGATACGAG 0.993701 -68 *** *** * *** Masking position 7 Map Score: 8.30325 Number of sites scoring better than the average of aligned sites = 259 Number in coding regions = 245 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 TCTTCCAGTTGATCCCATGAAGATATGCCA 1 16 0 GATCCCATGA 0.99475 -224 GAAAATAAGGGATACATTGAAGATAGTTGG 1 44 1 GATACATTGA 0.930122 -196 GATAGTTGGGGCTCCAACGACAGCTTACGA 1 65 1 GCTCCAACGA 0.996593 -175 ACTAGGTATAGATCCCGAGATTATAATAGA 1 95 1 GATCCCGAGA 0.984361 -145 TATAATAGAAGCTCTAACGATAGCCCATAC 1 116 1 GCTCTAACGA 0.982438 -124 ********** Masking position 3 Map Score: 4.54467 Number of sites scoring better than the average of aligned sites = 225 Number in coding regions = 210 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 TCCAGTTGATCCCATGAAGATATGCCATAATT 1 11 0 CCCAGAAGTA 0.988469 -229 AGGTATAGATCCCGAGATTATAATAGAAGCTC 1 98 1 CCCGGATTTA 0.998252 -142 GCCTTCCTTACCCAGGATTGTATATCTCTCTG 1 154 0 CCCAGATTTA 0.997293 -86 TCAAATTACACCCGTTATTTTAGCAGCCTTTT 1 205 0 CCCGTATTTA 0.993091 -35 **** **** ** Masking position 7 Map Score: 4.51898 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 17 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ACATTGAAGATAGTTGGGGCTCCAACGACA 1 57 1 TAGTTGGGGC 0.970537 -183 TCTGGCCTAATTGTATGGGCTATCGTTAGA 1 128 0 TTGTATGGGC 0.985576 -112 TTAGCAGCCTTTTCAGCGGCCTCTCTAGTT 1 188 0 TTTCAGCGGC 0.984551 -52 ACACCCGTTATTTTAGCAGCCTTTTCAGCG 1 200 0 TTTTAGCAGC 0.979683 -40 CGGGTGTAATTTGAAGGAGGTGTTATT 1 223 1 TTGAAGGAGG 0.946775 -17 ********** Masking position 1 Map Score: 1.24733 Number of sites scoring better than the average of aligned sites = 364 Number in coding regions = 339 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 5 CCATACAATTAGGCCAGAGAGATATACAAT 1 140 1 AGGCCAGAGA 0.986592 -100 ATAACTAGAGAGGCCGCTGAAAAGGCTGCT 1 186 1 AGGCCGCTGA 0.998465 -54 GCCGCTGAAAAGGCTGCTAAAATAACGGGT 1 198 1 AGGCTGCTAA 0.988743 -42 ********** Masking position 1 Map Score: 0.708773 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 50 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0