AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -irhaS_pyro_opreg_300.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH0864 300 208aa long hypothetical transcription initiation factor IIB Motif number 1 TTTCGAAGTGATAGCCTTGGGAGATATGTGTTC 1 13 0 ATACTTGGAG 0.989372 -288 TTATTATCTTCCACTTTTCGAAGTGATAGCCTT 1 28 0 CCATTTGAAG 0.982425 -273 CCCATATTATATATACTTGGAAGGTAAACTTTA 1 113 0 ATACTTGAAG 0.992823 -188 AACTGGACACCTAATCTTGGATCCCCCATATTA 1 137 0 CTACTTGATC 0.961584 -164 GGGGTCATAAATAATTTTTGAAGAACCACAAAC 1 167 0 ATATTTGAAG 0.988762 -134 TCCTTTGATACTAGGGTTAGAACATTTTCTTCT 1 245 1 CTAGTTGAAC 0.97825 -56 TCTTCTCCCCCTAAGTTTAGGAGTAAGGGAACT 1 272 1 CTATTTGGAG 0.991886 -29 *** *** **** Masking position 3 Map Score: 8.34306 Number of sites scoring better than the average of aligned sites = 143 Number in coding regions = 134 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 2 CCGAACACATATCTCCCAAGGCTATCACTT 1 10 1 TATCTCCAAG 0.978804 -291 CCCAAGGCTATCACTTCGAAAAGTGGAAGAT 1 25 1 TCACTTCAAA 0.89211 -276 AAAACAACAGTTTCCTTGAAGTTTAAATTTC 1 60 1 TTTCCTTAAG 0.895314 -241 TTTAAATACCTTTCTCTAAAAAATTTGAAAT 1 86 0 TTTCTCTAAA 0.938582 -215 ATTTAAAGTTTACCTTCCAAGTATATATAAT 1 110 1 TACCTTCAAG 0.96022 -191 CCAGTTTGTGGTTCTTCAAAAATTATTTATG 1 164 1 GTTCTTCAAA 0.92848 -137 ACATTTTCTTCTCCCCCTAAGTTTAGGAGTA 1 266 1 CTCCCCCAAG 0.93878 -35 CGAAGTTCCCTTACTCCTAAACTTAGGGGGA 1 277 0 TTACTCCAAA 0.972875 -24 ******* *** Masking position 9 Map Score: 3.66806 Number of sites scoring better than the average of aligned sites = 971 Number in coding regions = 886 Number in noncoding regions = 85 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 3 CCGAACACATATCTCCCAAGGCTATCA 1 8 1 CATATCTCCC 0.955172 -293 TGTTGTTTTTATTATCTTCCACTTTTCGAA 1 39 0 ATTATCTTCC 0.991419 -262 GTAAACTTTAAATACCTTTCTCTAAAAAAT 1 93 0 AATACCTTTC 0.943436 -208 GTATTTAAAGTTTACCTTCCAAGTATATAT 1 108 1 TTTACCTTCC 0.980145 -193 GGGTTAGAACATTTTCTTCTCCCCCTAAGT 1 258 1 ATTTTCTTCT 0.870626 -43 ********** Masking position 7 Map Score: 1.10057 Number of sites scoring better than the average of aligned sites = 628 Number in coding regions = 575 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 4 AAAAGTGGAAGATAATAAAAACAACAGTTT 1 43 1 GATAATAAAA 0.892801 -258 TAAAAAATTTGAAATTTAAACTTCAAGGAA 1 71 0 GAAATTTAAA 0.950318 -230 TTTAGAGAAAGGTATTTAAAGTTTACCTTC 1 97 1 GGTATTTAAA 0.984025 -204 ATATATACTTGGAAGGTAAACTTTAAATAC 1 108 0 GGAAGGTAAA 0.94226 -193 AGTGCGGCCACGTAATTAAATCCTTTGATA 1 225 1 CGTAATTAAA 0.945525 -76 ********** Masking position 4 Map Score: 0.575766 Number of sites scoring better than the average of aligned sites = 282 Number in coding regions = 243 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0