AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -irpoE_pyro_opreg_100.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH1410 117 332aa long hypothetical dipeptide transport system permease protein dppB #2 PH1414 26 129aa long hypothetical protein #3 PH1415 93 343aa long hypothetical 5' nuclease Motif number 1 GGGCAATAAAGAAAAGAGAGAAGAAAGATTA 1 7 0 GAAAGAAAGA 0.979684 -111 AAATTTTGGTGTTTAAATAAGGGCAATAAAGAAAA 1 27 0 GTTATAGGGA 0.949255 -91 GAACAAGAATGTACAAGGAGGGGCAAAT 1 100 1 GTAAGAGGGA 0.997964 -18 CAAAAATTGAAAAAAGAAGAGGATAT 2 4 0 GAAAGAGAGA 0.996802 -23 CCCCTCACCTGAAAGGTGATGAGCACACCGGTAGG 3 55 1 GAAGGAGAGA 0.996145 -39 GAGCACACCGGTAGGCTGAGGGTGATAAT 3 75 1 GTAGGAGGTA 0.984341 -19 *** * ** *** * Masking position 9 Map Score: 5.94451 Number of sites scoring better than the average of aligned sites = 273 Number in coding regions = 254 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 TTTCTTCTCTCTTTTCTTTATTGCCCTTAT 1 16 1 CTTTTCTTTA 0.94387 -102 AATAAAAATTTTGGTGTTTAAATAAGGGCA 1 37 0 TTGGTGTTTA 0.953677 -81 AACACCAAAATTTTTATTTATGCGATAATA 1 49 1 TTTTTATTTA 0.960049 -69 TTGTACATTCTTGTTCTATAACATCGTTTG 1 86 0 TTGTTCTATA 0.983239 -32 ATTGTTATAAACTTTCAGAGA 3 2 1 TTGTTATAAA 0.917577 -92 ********** Masking position 5 Map Score: 1.40199 Number of sites scoring better than the average of aligned sites = 110 Number in coding regions = 94 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 AAAAGAGAGAAGAAAGATTA 1 1 0 AGAAAGATTA 0.956347 -117 TTATAGAACAAGAATGTACAAGGAGGGGCA 1 95 1 AGAATGTACA 0.910661 -23 TTGATATCTCTGAAAGTTTATAACAAT 3 8 0 TGAAAGTTTA 0.971929 -86 TCAGGTGAGGGGAAGGTTCATCATCAGACT 3 37 0 GGAAGGTTCA 0.960684 -57 TCCCCTCACCTGAAAGGTGATGAGCACACC 3 54 1 TGAAAGGTGA 0.964077 -40 ********** Masking position 4 Map Score: 0.873881 Number of sites scoring better than the average of aligned sites = 328 Number in coding regions = 292 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0