AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -isoxS_pyro_opreg_300.orf -g0.419 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.419 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 PH0623 58 153aa long hypothetical protein #2 PH0686 30 263aa long hypothetical ORFZ protein #3 PH1905 90 281aa long hypothetical protein Motif number 1 ATTAGCTTGAAAATGTTGACTATCGT 1 3 0 AAAGTTTATC 0.976735 -56 TCCAATTTATAAATATTAGCTTGAAAATGTTGAC 1 17 0 AAAATTTTGA 0.86731 -42 ACGATAAATAGTTTAATTTCCAATTTATAA 1 39 0 AATGTTTTTC 0.989962 -20 GGTTTTTAATCTTTCTCCTTCTTTTCTCCT 2 8 1 AATTTTCTTC 0.967222 -23 CGAAAACTCTATTTTTCTTGGCTATTT 3 4 1 AAATCTTTTC 0.961831 -87 CCTCTAAAGCAATTTTTAAATAGCCAAGAAAAAT 3 21 0 AATTTTTAGC 0.971709 -70 AGGTTGCTCTAAAATTTAACGTTAATCCTCTAAA 3 47 0 AAATTTGTTA 0.781089 -44 ACTTCCCTCGAATAGTTAGGTTGCTCTAAAATTT 3 64 0 AATGTTTTGC 0.991245 -27 *** *** **** Masking position 2 Map Score: 6.22228 Number of sites scoring better than the average of aligned sites = 442 Number in coding regions = 373 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 92 Fraction of orfs with sites within 600 bp upstream = 0.0147767 Motif number 2 ACGATAAATAGTTTAATTTC 1 49 0 ACGATAAATA 0.946729 -10 GGAGAAAAGAAGGAGAAAGATTAAAAACC 2 10 0 AGGAGAAAGA 0.990927 -21 AGGAGAAAAGAAGGAGAAAG 2 21 0 AGGAGAAAAG 0.991303 -10 ATTGCTTTAGAGGATTAACGTTAAATTTTA 3 42 1 AGGATTAACG 0.977387 -49 ********** Masking position 4 Map Score: 1.49757 Number of sites scoring better than the average of aligned sites = 313 Number in coding regions = 296 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 3 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0