AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_rpxx.txt -z/home/amcguire/genomes/rpxx.fna -imelR_rpxx_opreg_100.orf -g0.290 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.29 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 RP500 215 ADP,ATP CARRIER PROTEIN (tlc4) Motif number 1 GAATATATGATATAAAATGCAAAATTGATA 1 11 1 TATAAAATGC 0.988457 -205 GAGCAAAAAGTTTATAATGCAAGGAGCATT 1 62 1 TTTATAATGC 0.994344 -154 TACTCATGCATTAATAATGCTCCTTGCATT 1 77 0 TTAATAATGC 0.98162 -139 CTTAGCCAATTTTAAAATTAAACGAGTATA 1 128 1 TTTAAAATTA 0.91255 -88 AAATCTTTAATATATAATTCTAGCCAATAG 1 177 1 TATATAATTC 0.981933 -39 ********** Masking position 6 Map Score: 7.00678 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 95 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 AAATTGATAGACACAGTTTAATTTCAACAA 1 32 1 ACACAGTTTA 0.993103 -184 CAACAAGAGCAAAAAGTTTATAATGCAAGG 1 56 1 AAAAAGTTTA 0.929946 -160 CATGAGTACTACAGAGCTTATTAAGACAAC 1 99 1 ACAGAGCTTA 0.991795 -117 GAGCTTATTAAGACAACTTAGCCAATTTTA 1 112 1 AGACAACTTA 0.940939 -104 TAGCCAATAGACATAGGTTAGACTCAATA 1 197 1 ACATAGGTTA 0.977974 -19 ********** Masking position 5 Map Score: 3.52657 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 39 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AATGCAAAATTGATAGACACAGTTTAATTT 1 26 1 TGATAGACAC 0.981521 -190 TAATAAGCTCTGTAGTACTCATGCATTAAT 1 92 0 TGTAGTACTC 0.952736 -124 TTTAAGTCAAGGATATACTCGTTTAATTTT 1 141 0 GGATATACTC 0.989188 -75 AATAGACATAGGTTAGACTCAATA 1 202 1 GGTTAGACTC 0.994886 -14 ********** Masking position 7 Map Score: 2.44119 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 7 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 GAATATATGATATAAAATGCAA 1 3 1 ATATATGATA 0.888282 -213 TATAAAATGCAAAATTGATAGACACAGTTT 1 21 1 AAAATTGATA 0.933495 -195 ACAAGAGCAAAAAGTTTATAATGCAAGGAG 1 58 1 AAAGTTTATA 0.875462 -158 TTTAATTTTAAAATTGGCTAAGTTGTCTTA 1 120 0 AAATTGGCTA 0.983661 -96 TATATATTAAAGATTTTCTACATTTAAGTC 1 163 0 AGATTTTCTA 0.935036 -53 TAACCTATGTCTATTGGCTAGAATTATATA 1 187 0 CTATTGGCTA 0.938884 -29 ********** Masking position 3 Map Score: 0.737794 Number of sites scoring better than the average of aligned sites = 744 Number in coding regions = 532 Number in noncoding regions = 212 Number of orfs with sites within 600 bp upstream = 117 Fraction of orfs with sites within 600 bp upstream = 0.0187922 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0