AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_rpxx.txt -z/home/amcguire/genomes/rpxx.fna -imelR_rpxx_opreg_300.orf -g0.290 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.29 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 RP500 215 ADP,ATP CARRIER PROTEIN (tlc4) Motif number 1 GAATATATGATATAAAATGCAAAATTGATA 1 11 1 TATAAAATGC 0.988093 -205 GAGCAAAAAGTTTATAATGCAAGGAGCATT 1 62 1 TTTATAATGC 0.994165 -154 TACTCATGCATTAATAATGCTCCTTGCATT 1 77 0 TTAATAATGC 0.981053 -139 CTCGTTTAATTTTAAAATTGGCTAAGTTGT 1 124 0 TTTAAAATTG 0.937454 -92 AAATCTTTAATATATAATTCTAGCCAATAG 1 177 1 TATATAATTC 0.981395 -39 ********** Masking position 6 Map Score: 7.00678 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 95 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 TTGTTGAAATTAAACTGTGTCTATCAATTT 1 32 0 TAAACTGTGT 0.992774 -184 CCTTGCATTATAAACTTTTTGCTCTTGTTG 1 56 0 TAAACTTTTT 0.926831 -160 GTTGTCTTAATAAGCTCTGTAGTACTCATG 1 99 0 TAAGCTCTGT 0.991405 -117 TAAAATTGGCTAAGTTGTCTTAATAAGCTC 1 112 0 TAAGTTGTCT 0.938272 -104 TATTGAGTCTAACCTATGTCTATTGGCTA 1 197 0 TAACCTATGT 0.976938 -19 ********** Masking position 6 Map Score: 3.52657 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 39 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AAATTAAACTGTGTCTATCAATTTTGCATT 1 26 0 GTGTCTATCA 0.97978 -190 ATTAATGCATGAGTACTACAGAGCTTATTA 1 92 1 GAGTACTACA 0.948419 -124 AAAATTAAACGAGTATATCCTTGACTTAAA 1 141 1 GAGTATATCC 0.988783 -75 TATTGAGTCTAACCTATGTCTATT 1 202 0 GAGTCTAACC 0.994456 -14 ********** Masking position 4 Map Score: 2.44119 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 7 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 TGCTCTTGTTGAAATTAAACTGTGTCTATC 1 37 0 GAAATTAAAC 0.97876 -179 AGCCAATTTTAAAATTAAACGAGTATATCC 1 131 1 AAAATTAAAC 0.968841 -85 AAAGATTTTCTACATTTAAGTCAAGGATAT 1 155 0 TACATTTAAG 0.948021 -61 GCTAGAATTATATATTAAAGATTTTCTACA 1 171 0 TATATTAAAG 0.96884 -45 ********** Masking position 5 Map Score: 0.44814 Number of sites scoring better than the average of aligned sites = 224 Number in coding regions = 146 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0