AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_rpxx.txt -z/home/amcguire/genomes/rpxx.fna -irpoE_rpxx_opreg_100.orf -g0.290 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.29 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 RP123 143 HFLC PROTEIN (hflC) #2 RP124 30 PROBABLE PERIPLASMIC SERINE PROTEASE DO-LIKE PRECURSOR (htrA) #3 RP303 89 RNA POLYMERASE SIGMA-32 FACTOR (rpoH) Motif number 1 AACATCGTAGTACTTTAGCATGATATATCTAATT 1 9 0 TTTTAATAAT 0.994531 -135 GATGTTCACATCATTTAGGATAAGATTTTATCTCAT 1 39 1 TTTTAATAAT 0.994531 -105 GGATCTTTGCTCTTTTTGAAGTTGATCTTCTTACAA 1 76 1 TTTTTAGTAT 0.974258 -68 CTTACAAGGCTTTTTTAGTATGATATTATAAAATAA 1 105 1 TTTTAATAAT 0.994531 -39 TTAATATTCCTTATTATTTTATAATATCATAC 1 122 0 TCTTAATTAT 0.957059 -22 TTTTCTATAATTTTTTTAAATAAAATCAAACA 3 7 0 TTTTTATAAT 0.993041 -83 TAGAAAAAGTTTATTTTAGATCATATATATGTTAGT 3 36 1 TTTTTATAAT 0.993263 -54 AAAACTATTTTCGTTTATACTAACATATATATGATC 3 54 0 TTTTACTAAT 0.977005 -36 TAAACGAAAATAGTTTTTCAGGTTATT 3 73 1 TTTTTAGTAT 0.974258 -17 * **** ** * ** Masking position 6 Map Score: 19.3345 Number of sites scoring better than the average of aligned sites = 267 Number in coding regions = 163 Number in noncoding regions = 104 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 2 TTTAGCATGATATATCTAATT 1 2 0 TATATCTAAT 0.950317 -142 CATTTAGGATAAGATTTTATCTCATTGGAT 1 50 1 AAGATTTTAT 0.968613 -94 AAAAAGAGCAAAGATCCAATGAGATAAAAT 1 63 0 AAGATCCAAT 0.903753 -81 CTTTTTGAAGTTGATCTTCTTACAAGGCTT 1 87 1 TTGATCTTCT 0.965184 -57 AATATTCCTTATTATTTTATAATATCATAC 1 122 0 ATTATTTTAT 0.881601 -22 TATATTTACTGTCGTCTTTA 2 1 1 TATATTTACT 0.872316 -30 TGTTTGATTTTATTTAAAAAAAT 3 4 1 TTGATTTTAT 0.968614 -86 AAGTTTATTTTAGATCATATATATGTTAGT 3 42 1 TAGATCATAT 0.942213 -48 ********** Masking position 4 Map Score: 6.95047 Number of sites scoring better than the average of aligned sites = 730 Number in coding regions = 511 Number in noncoding regions = 219 Number of orfs with sites within 600 bp upstream = 107 Fraction of orfs with sites within 600 bp upstream = 0.017186 Motif number 3 AATTAGATATATCATGCTAAAGTACTAC 1 9 1 ATATCATGCT 0.978353 -135 AATGATGTGAACATCGTAGTACTTTAGCAT 1 24 0 ACATCGTAGT 0.973066 -120 TTATTTTATAATATCATACTAAAAAAGCCT 1 111 0 ATATCATACT 0.987187 -33 TAGATCATATATATGTTAGTATAAACGAAA 3 52 1 ATATGTTAGT 0.942198 -38 ********** Masking position 4 Map Score: 0.37009 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 42 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: -1.1836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.1836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.1836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0