AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_rpxx.txt -z/home/amcguire/genomes/rpxx.fna -irpoE_rpxx_opreg_300.orf -g0.290 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.29 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 RP122 98 HFLK PROTEIN (hflK) #2 RP123 143 HFLC PROTEIN (hflC) #3 RP124 30 PROBABLE PERIPLASMIC SERINE PROTEASE DO-LIKE PRECURSOR (htrA) #4 RP303 89 RNA POLYMERASE SIGMA-32 FACTOR (rpoH) Motif number 1 GTGATTATATATATAATAGTATATAACGTCAAGTTA 1 45 0 ATTATTATAA 0.952675 -54 TAATCTTAAAATAATATAAAAAAGCAA 1 82 1 ATAATAAAAA 0.987438 -17 AATTAGATATATCATGCTAAAGTACTACGATGTT 2 9 1 ATTATTAAAA 0.993728 -135 ATGAGATAAAATCTTATCCTAAATGATGTGAACATC 2 39 0 ATTATTAAAA 0.993728 -105 TTGTAAGAAGATCAACTTCAAAAAGAGCAAAGATCC 2 76 0 ATACTAAAAA 0.967918 -68 TTATTTTATAATATCATACTAAAAAAGCCTTGTAAG 2 105 0 ATTATTAAAA 0.993728 -39 GTATGATATTATAAAATAATAAGGAATATTAA 2 122 1 ATAATTAAGA 0.946212 -22 TGTTTGATTTTATTTAAAAAAATTATAGAAAA 4 7 1 ATTATAAAAA 0.992465 -83 ACTAACATATATATGATCTAAAATAAACTTTTTCTA 4 36 0 ATTATAAAAA 0.992553 -54 GATCATATATATGTTAGTATAAACGAAAATAGTTTT 4 54 1 ATTAGTAAAA 0.96757 -36 AATAACCTGAAAAACTATTTTCGTTTA 4 73 0 ATACTAAAAA 0.967918 -17 ** * ** **** * Masking position 11 Map Score: 24.2673 Number of sites scoring better than the average of aligned sites = 357 Number in coding regions = 215 Number in noncoding regions = 142 Number of orfs with sites within 600 bp upstream = 96 Fraction of orfs with sites within 600 bp upstream = 0.0154192 Motif number 2 AACTTGACGTTATATACTATTATATATATAA 1 46 1 TATATACATT 0.960145 -53 TATACTATTATATATATAATCACTTAATCTT 1 58 1 TATATATATC 0.985485 -41 TTGCTTTTTTATATTATTTTAAGATTAA 1 81 0 TTTATATATT 0.977048 -18 TTTAGCATGATATATCTAATT 2 1 0 TATATCTATT 0.948205 -143 AGGATAAGATTTTATCTCATTGGATCTTTGC 2 55 1 TTTATCTATT 0.948206 -89 TCCTTATTATTTTATAATATCATACTAAAAA 2 116 0 TTTATAAATC 0.961186 -28 ATAATTTTTTTAAATAAAATCAAACA 4 6 0 TAAATAAATC 0.777652 -84 AAATAAACTTTTTCTATAATTTTTTTAAATA 4 21 0 TTTCTATATT 0.898777 -69 TATACTAACATATATATGATCTAAAATAAAC 4 44 0 TATATATATC 0.985479 -46 ACTATTTTCGTTTATACTAACATATATATGA 4 56 0 TTTATACAAC 0.843989 -34 ******* *** Masking position 5 Map Score: 15.3375 Number of sites scoring better than the average of aligned sites = 398 Number in coding regions = 246 Number in noncoding regions = 152 Number of orfs with sites within 600 bp upstream = 84 Fraction of orfs with sites within 600 bp upstream = 0.0134918 Motif number 3 GACGTTATATACTATTATATATATAATCAC 1 51 1 ACTATTATAT 0.958841 -48 GTAGTACTTTAGCATGATATATCTAATT 2 9 0 AGCATGATAT 0.966245 -135 ATGCTAAAGTACTACGATGTTCACATCATT 2 24 1 ACTACGATGT 0.960384 -120 AGGCTTTTTTAGTATGATATTATAAAATAA 2 111 1 AGTATGATAT 0.984507 -33 TTTCGTTTATACTAACATATATATGATCTA 4 52 0 ACTAACATAT 0.931811 -38 ********** Masking position 4 Map Score: 1.72216 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 33 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 AGCTTTAAAAAGGAAATTTAATT 1 3 0 AGGAATTTAA 0.959164 -96 TACCAGCTTAAAGAGCTTTAAAAAGGAAATT 1 16 0 AAGAGTTTAA 0.917208 -83 TTAATCTTAAAATAATATAAAAAAGCAA 1 81 1 AATAAATAAA 0.848009 -18 AAAGCCTTGTAAGAAGATCAACTTCAAAAAG 2 87 0 AAGAAATCAA 0.97825 -57 TAAAATAATAAGGAATATTAA 2 133 1 AGGAAATTAA 0.974284 -11 AATTTTTTTAAATAAAATCAAACA 4 4 0 AATAAATCAA 0.938332 -86 GATTTTATTTAAAAAAATTATAGAAAAAGTT 4 16 1 AAAAAATTAT 0.891877 -74 AAAATTATAGAAAAAGTTTATTTTAGATCAT 4 29 1 AAAAATTTAT 0.829926 -61 ***** ***** Masking position 4 Map Score: 5.31676 Number of sites scoring better than the average of aligned sites = 719 Number in coding regions = 490 Number in noncoding regions = 229 Number of orfs with sites within 600 bp upstream = 126 Fraction of orfs with sites within 600 bp upstream = 0.0202377 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0