AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -ifis_mthe_opreg_100.orf -g0.495 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.495 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 MTH176 168 tRNA-guanine transglycosylase #2 MTH848 103 protein-export membrane protein, SecF Motif number 1 TATGTGATCCAGCCCTGCTTCCAGTGT 1 7 1 ATCCAGCCTG 0.995823 -162 CTCCCACATAATCCATGCCTCAGAAACACTG 1 32 0 ATCCATCCTC 0.991411 -137 ATCTGGTGGTAGCCACTGCAGAGTACCTGTT 1 131 1 AGCCACGCAG 0.982991 -38 TTTTAAAGTCATACAGGCCACTCATAGCCAT 2 63 1 ATACAGCCAC 0.950679 -41 GGCCACTCATAGCCATACCAGCAGCCATAAC 2 78 1 AGCCATCCAG 0.997128 -26 CCATACCAGCAGCCATAACTGTAA 2 90 1 AGCCATACTG 0.985194 -14 ****** **** Masking position 5 Map Score: 7.62891 Number of sites scoring better than the average of aligned sites = 306 Number in coding regions = 279 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 ATTTTTAGGGTGCTGATTACATATTAATCA 1 64 1 TGCTGATTAC 0.996676 -105 TCCACGATGATACTGATTAATATGTAATCA 1 77 0 TACTGATTAA 0.992083 -92 TGGTAGCCACTGCAGAGTACCTGTTAATCA 1 137 1 TGCAGAGTAC 0.985837 -32 GCAGAATGATACTGATTAACAGGTACTCT 1 150 0 TACTGATTAA 0.992083 -19 ********** Masking position 6 Map Score: 5.60847 Number of sites scoring better than the average of aligned sites = 11 Number in coding regions = 10 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 TCTGAGGCATGGATTATGTGGGAGGATTTTT 1 39 1 GGATTATGGG 0.983823 -130 TTATGTGGGAGGATTTTTAGGGTGCTGATTA 1 52 1 GGATTTTTGG 0.946951 -117 ATATTAATCAGTATCATCGTGGATATACACT 1 84 1 GTATCATCTG 0.983772 -85 ATCTGAGCATGTAGTATCTGGTGGTAGCCAC 1 116 1 GTAGTATCGG 0.969606 -53 AGAATGATACTGATTAACAGGTACTCTGCAG 1 146 0 TGATTAACGG 0.923823 -23 CTGTTAATCAGTATCATTCTGC 1 157 1 GTATCATTTG 0.953453 -12 ACTTTAAAGGTGATCGTCTTGATTGACCGCA 2 32 1 TGATCGTCTG 0.925863 -72 ******** ** Masking position 3 Map Score: 2.86992 Number of sites scoring better than the average of aligned sites = 839 Number in coding regions = 785 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 4 CCTAAAAATCCTCCCACATAATCCATGCCT 1 43 0 CTCCCACATA 0.9216 -126 ATACTACATGCTCAGATCAGTGTATATCCA 1 103 0 CTCAGATCAG 0.941272 -66 TCTGCAGTGGCTACCACCAGATACTACATG 1 123 0 CTACCACCAG 0.995032 -46 TTTAAAGTTTCTCCCATCTGTCAAATAGA 2 10 0 CTCCCATCTG 0.995172 -94 ACTCATAGCCATACCAGCAGCCATAACTGT 2 82 1 ATACCAGCAG 0.954875 -22 ********** Masking position 6 Map Score: 1.55678 Number of sites scoring better than the average of aligned sites = 781 Number in coding regions = 734 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 5 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0