AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -imelR_mthe_opreg_100.orf -g0.495 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.495 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 MTH1142 300 H(2)-dependent N5,N10-methylenetetrahydromethanopterin dehydrogenase Motif number 1 TAATCATAATTATTAAGATATTAATATCACGG 1 65 0 TATAAATATT 0.949066 -236 TATAATATTATATGAAAATAATCATAATTATT 1 83 0 TATAAATAAT 0.980732 -218 CATATAATATTATATGGATAATGGATGGTAAA 1 101 1 TATTGATAAT 0.935287 -200 TCAAAAAACTTATAAGGAGAATTTATTCACCT 1 195 0 TATAGAGAAT 0.987518 -106 AGTTTTTTGATTTGAAAATTATCAAAAAATAT 1 217 1 TTTAAATTAT 0.850432 -84 CGGTTTCCAATATAAATATATTTTTTGATAAT 1 234 0 TATAAATATT 0.94888 -67 CTACTTATATTATTAGTAGTACAGATTAATCG 1 264 0 TATAGAGTAC 0.929087 -37 CTACTAATAATATAAGTAGTATTACAGAAATG 1 277 1 TATAGAGTAT 0.980129 -24 *** ** ***** Masking position 8 Map Score: 7.94526 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 109 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 TCCTAACTGGAAGGCTGCCCTTAA 1 5 0 AAGGCTGCCC 0.998818 -296 ATGGATGGTAAAGGCTTCCCAAAGGAGGAT 1 121 1 AAGGCTTCCC 0.998258 -180 ********** Masking position 6 Map Score: 1.29507 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 6 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 GCCACAGATCCGTGATATTAATATCTTAAT 1 56 1 CGTGATATTA 0.807155 -245 CATCCATTATCCATATAATATTATATGAAA 1 98 0 CCATATAATA 0.769187 -203 TCCCAAAGGAGGATAAAATGAAAACATTGC 1 137 1 GGATAAAATG 0.70361 -164 TGAAAACATTGCTTAAATTGACTTACCCTG 1 155 1 GCTTAAATTG 0.960436 -146 ATTGACTTACCCTGAAATTGCCACAGGTGA 1 171 1 CCTGAAATTG 0.966807 -130 AAATCAAAAAACTTATAAGGAGAATTTATT 1 200 0 ACTTATAAGG 0.722661 -101 CAAAAAATATATTTATATTGGAAACCGATT 1 239 1 ATTTATATTG 0.824205 -62 CTGTAATACTACTTATATTATTAGTAGTAC 1 274 0 ACTTATATTA 0.922049 -27 AAGTAGTATTACAGAAATGGA 1 290 1 ACAGAAATGG 0.861206 -11 ********** Masking position 5 Map Score: 1.94288 Number of sites scoring better than the average of aligned sites = 935 Number in coding regions = 823 Number in noncoding regions = 112 Number of orfs with sites within 600 bp upstream = 117 Fraction of orfs with sites within 600 bp upstream = 0.0187922 Motif number 4 AATAATTATGATTATTTTCATATAATATTA 1 83 1 ATTATTTTCA 0.907532 -218 CAATTTAAGCAATGTTTTCATTTTATCCTC 1 145 0 AATGTTTTCA 0.973513 -156 TTATAAGGAGAATTTATTCACCTGTGGCAA 1 188 0 AATTTATTCA 0.950112 -113 TCTCCTTATAAGTTTTTTGATTTGAAAATT 1 207 1 AGTTTTTTGA 0.96188 -94 AATATAAATATATTTTTTGATAATTTTCAA 1 228 0 TATTTTTTGA 0.928951 -73 ********** Masking position 5 Map Score: 1.44507 Number of sites scoring better than the average of aligned sites = 136 Number in coding regions = 84 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0