AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -inagC_mthe_opreg_100.orf -g0.495 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.495 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 MTH171 141 glutamine-fructose-6-phosphate transaminase #2 MTH1591 30 phosphonopyruvate decarboxylase #3 MTH1592 21 conserved protein #4 MTH1593 205 ribosomal protein S3a Motif number 1 ATACTCAAATTCTTTAAAAGTGATAGT 1 8 0 TCTTTAAAAG 0.91499 -134 ACTGAATCGCAATATAACTCATAATAGAAT 1 77 0 AATATAACTC 0.898942 -65 TTCGCAAGATTATATAACTGAATCGCAATA 1 93 0 TATATAACTG 0.980214 -49 GATAAGGGAGTATTTAAATCTTGACATGGT 4 59 0 TATTTAAATC 0.916343 -147 TATGGAATACTCTATAATAGGATAAGGGAG 4 79 0 TCTATAATAG 0.824377 -127 ACTGGCGGTGTATGTAACTCTAAATCATGG 4 108 1 TATGTAACTC 0.966765 -98 AAAAAATTCATATTTAACTGGTTAACCATG 4 133 0 TATTTAACTG 0.983528 -73 ATCACCTTAATCTTTAACACCGTAAAAACA 4 183 0 TCTTTAACAC 0.97531 -23 ********** Masking position 6 Map Score: 8.23076 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 71 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 2 GTTGATCAGGATTTCATACTCAAATTCTTT 1 23 0 ATTTCATACT 0.897236 -119 ATCGCAATATAACTCATAATAGAATTTACA 1 72 0 AACTCATAAT 0.792428 -70 TAATCTTGCGAAATCAGATTCATGCTTCTT 1 111 1 AAATCAGATT 0.870763 -31 TATTTCACCCTAAGAAGCATG 1 131 0 ATTTCACCCT 0.956682 -11 GATTAACCCACCTTCCTAGATTTA 2 17 0 AACCCACCTT 0.960077 -14 ACAGCACCCCAAACCACCATGTCAAGATTT 4 44 1 AAACCACCAT 0.906466 -162 ATTATAGAGTATTCCATACTGGCGGTGTAT 4 91 1 ATTCCATACT 0.904386 -115 AAATTCAAAAAATTCATATTTAACTGGTTA 4 139 0 AATTCATATT 0.928757 -67 ATTTATGTTAAATCCAGCTGTTTTTACGGT 4 165 1 AATCCAGCTG 0.795725 -41 TATATCACCTTAATCTTTAAC 4 195 0 ATATCACCTT 0.933533 -11 ********** Masking position 6 Map Score: 6.28601 Number of sites scoring better than the average of aligned sites = 633 Number in coding regions = 540 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 3 TTGGAGAGTTGATCAGGATTTCATACTCAA 1 30 0 GATCAGGATT 0.878931 -112 TCACCCTAAGAAGCATGAATCTGATTTCGC 1 118 0 AAGCATGAAT 0.857405 -24 AGATCATAAATCTAGGAAGGT 2 2 1 GATCATAAAT 0.950961 -29 GGTGCTGTGTGGTCATGAATATGAACAGCC 4 22 0 GGTCATGAAT 0.962135 -184 TTAACTGGTTAACCATGATTTAGAGTTACA 4 120 0 AACCATGATT 0.577585 -86 ********** Masking position 5 Map Score: 1.77938 Number of sites scoring better than the average of aligned sites = 145 Number in coding regions = 119 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 4 ********** No masking Map Score: 2.36911e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.36911e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.36911e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0