AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -ideoR_tpal_opreg_100.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP0261 114 catabolite gene activator, putative Motif number 1 AGAGATCGTTCGCACGCCTTTTCCAGGAAA 1 16 0 CGCACGCCTT 0.998773 -99 CGCTCCTGCGCGCACACCTGCAGAGATCGT 1 37 0 CGCACACCTG 0.999265 -78 ATTCACGTCACGCGCTCCTGCGCGCACACC 1 49 0 CGCGCTCCTG 0.996812 -66 ********** Masking position 9 Map Score: 7.08392 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 74 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 TGCAGAGATCGTTCGCACGCCTTTTCCAGGA 1 18 0 GTCGCACGCC 0.99842 -97 ACGCGCTCCTGCGCGCACACCTGCAGAGATC 1 39 0 GGCGCACACC 0.998442 -76 GTGCGCGCAGGAGCGCGTGACGTGAATTCTG 1 52 1 GGCGCGTGAC 0.998403 -63 AAAAAGACTTAAGTGCATGACCGTTCTATCG 1 84 1 AGTGCATGAC 0.985411 -31 * ********* Masking position 6 Map Score: 4.66822 Number of sites scoring better than the average of aligned sites = 519 Number in coding regions = 470 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 3 TCGCACGCCTTTTCCAGGAAAGGTGG 1 7 0 TTTCCAGGAA 0.795534 -108 CTTAAGTCTTTTTCCAGAATTCACGTCACG 1 67 0 TTTCCAGAAT 0.794408 -48 ********** Masking position 6 Map Score: 0.818982 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 7 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 CCACCTTTCCTGGAAAAGGC 1 1 1 CCACCTTTCC 0.99414 -114 ATCGTTCGCACGCCTTTTCCAGGAAAGGTG 1 12 0 CGCCTTTTCC 0.985889 -103 AAAAGGCGTGCGAACGATCTCTGCAGGTGT 1 24 1 CGAACGATCT 0.827436 -91 CTTAAGTGCATGACCGTTCTATCGAAAATG 1 91 1 TGACCGTTCT 0.91655 -24 ********** Masking position 8 Map Score: 1.89105 Number of sites scoring better than the average of aligned sites = 226 Number in coding regions = 207 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0