AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -iglpR_tpal_opreg_100.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP0255 118 ribosomal protein L31 (rpmE) #2 TP0256 44 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase (pgsA) #3 TP0257 96 glycerophosphoryldiester phosphodiesterase (glpQ) #4 TP0979 169 conserved hypothetical protein #5 TP0981 59 sensory transduction histidine kinase, putative Motif number 1 CAGAAGGCTCGTACACGCCGGGTGTAACCGA 1 32 0 GACACGCCGG 0.975686 -87 ACCTTTTTAAGGGCGCGGCGCGCTGTAGAAT 1 79 1 GGCGCGGCGC 0.956234 -40 GAGTACACCTGTGGTGTACCA 2 1 1 GGTACACCTG 0.944217 -44 CCGTGCATAGTAGCACGCCGCATATCTCCAC 3 35 0 TGCACGCCGC 0.99432 -62 GCGGACATGCGCGCACGGCCCAGCT 4 5 0 GGCACGGCCC 0.991185 -165 GCACGCGAACTAGAACGGCCGACGCGGACAT 4 28 0 TGAACGGCCG 0.954946 -142 GTTCTAGTTCGCGTGCCCCTGTGCCCGCAAT 4 43 1 GGTGCCCCTG 0.980108 -127 TACCGCGCGTGTGTGCCGCGCGTTGCGCTTC 4 95 1 GGTGCCGCGC 0.988272 -75 CGTACCGCCCTGGTACGCCGGAAGCGCAACG 4 115 0 TGTACGCCGG 0.992395 -55 AGGCGCTCGCGCGTACCGCCCTGGTACGCCG 4 126 0 GGTACCGCCC 0.982452 -44 GGCGGTACGCGCGAGCGCCTCACAGCACTCA 4 137 1 GGAGCGCCTC 0.981065 -33 GTTGCACGGCTTTTCAAACCGC 5 2 1 TGCACGGCTT 0.892997 -58 AGTAAGTTGGGGTACGCCGGAAGCGTACGT 5 40 0 GGTACGCCGG 0.997802 -20 * ********* Masking position 6 Map Score: 30.3641 Number of sites scoring better than the average of aligned sites = 1239 Number in coding regions = 1133 Number in noncoding regions = 106 Number of orfs with sites within 600 bp upstream = 80 Fraction of orfs with sites within 600 bp upstream = 0.0128493 Motif number 2 CTGAATCGCTCCTTTCCCCATTCTACAGC 1 100 0 GCTCCTTCCC 0.99765 -19 GTGTACCATTACGTCTTTCCCCTAGGTGAGT 2 24 1 ACGTCTTCCC 0.986597 -21 GTAGCACGCCGCATATCTCCACTGAGCGCTGA 3 25 0 GCATATTCCC 0.96395 -72 TATGCGGCGTGCTACTATGCACGGTGACGATC 3 42 1 GCTACTTGCC 0.984264 -55 AAACTTCTCTCCTCCCCTGTTATA 3 83 0 ACTTCTTCCC 0.978906 -14 TGGGCCGTGCGCGCATGTCCGCGTCGGCCGTT 4 14 1 GCGCATTCCC 0.89041 -156 TAGTTCGCGTGCCCCTGTGCCCGCAATGGTTG 4 47 1 GCCCCTTGCC 0.988349 -123 CAAATACCGCGCGTGTGTGCCGCGCGTTGCGC 4 91 1 GCGTGTTGCG 0.906641 -79 GTACGCGCGAGCGCCTCACAGCACTCAGGATA 4 141 1 GCGCCTACAC 0.892271 -29 GGGCTAATATCCTGAGTGCTGTGA 4 156 0 GCTAATTCCG 0.926512 -14 ****** *** * Masking position 6 Map Score: 14.0952 Number of sites scoring better than the average of aligned sites = 506 Number in coding regions = 457 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 3 TTCCCCATTCTACAGCGCGCCGCGCCCTTA 1 86 0 TACAGCGCGC 0.988587 -33 CGTAATGGTACACCACAGGTGTACTC 2 7 0 CACCACAGGT 0.636287 -38 CGCATATCTCCACTGAGCGCTGATCCTACC 3 18 0 CACTGAGCGC 0.988638 -79 TTATAGAATGCACAGATCGTCACCGTGCAT 3 58 0 CACAGATCGT 0.732777 -39 AGCTGGGCCGTGCGCGCATGTCCGCGT 4 8 1 CCGTGCGCGC 0.97209 -162 ACAAAGCAACCATTGCGGGCACAGGGGCAC 4 55 0 CATTGCGGGC 0.937604 -115 TCTCCGCAAATACCGCGCGTGTGTGCCGCG 4 85 1 TACCGCGCGT 0.952719 -85 ACGCCGGAAGCGCAACGCGCGGCACACACG 4 102 0 CGCAACGCGC 0.985802 -68 CGTACCAGGGCGGTACGCGCGAGCGCCTCA 4 129 1 CGGTACGCGC 0.95485 -41 GCGAGCGCCTCACAGCACTCAGGATATTAG 4 147 1 CACAGCACTC 0.896273 -23 ********** Masking position 9 Map Score: 8.78912 Number of sites scoring better than the average of aligned sites = 3821 Number in coding regions = 3557 Number in noncoding regions = 264 Number of orfs with sites within 600 bp upstream = 149 Fraction of orfs with sites within 600 bp upstream = 0.0239319 Motif number 4 CCATTCTACAGCGCGCCGCGCCCTTAAAAA 1 82 0 GCGCGCCGCG 0.995013 -37 AGCTGGGCCGTGCGCGCATGTCCGCG 4 7 1 GCCGTGCGCG 0.991548 -163 GAACTAGAACGGCCGACGCGGACATGCGCG 4 23 0 GGCCGACGCG 0.994459 -147 TGCGGGCACAGGGGCACGCGAACTAGAACG 4 42 0 GGGGCACGCG 0.991975 -128 GCCCTGGTACGCCGGAAGCGCAACGCGCGG 4 110 0 GCCGGAAGCG 0.997789 -60 GCGTACCAGGGCGGTACGCGCGAGCGCCTC 4 128 1 GCGGTACGCG 0.997601 -42 GTTGGGGTACGCCGGAAGCGTACGTTTTTC 5 35 0 GCCGGAAGCG 0.997789 -25 ********** Masking position 8 Map Score: 19.3211 Number of sites scoring better than the average of aligned sites = 187 Number in coding regions = 171 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 5 GCGTGTACGAGCCTTCTGGAAGAGGGTGGATGTAAC 1 45 1 GCTTTAAGGG 0.995193 -74 GGGTGGATGTAACCTTTTTAAGGGCGCGGCGCGCTG 1 68 1 AACTTAAGCG 0.925903 -51 AGGGCGCGGCGCGCTGTAGAATGGGGAAAGGAGCGA 1 88 1 GCCTTAAGGG 0.997308 -31 GACGATCTGTGCATTCTATAACAGGGGAGGAGAGAA 3 67 1 GCTTTAAGGG 0.997106 -30 GTTGCACGGCTTTTCAAACCGCGTGAAAAACGT 5 8 1 GGTTTAAGCG 0.988264 -52 ** ** * ** *** Masking position 7 Map Score: 1.73309 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 30 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 6 ACCTGTGGTGTACCATTACGTCTTTCCCCT 2 17 1 TACCATTACG 0.982169 -28 GGGGCACGCGAACTAGAACGGCCGACGCGG 4 32 0 AACTAGAACG 0.924035 -138 AGAACAAAGCAACCATTGCGGGCACAGGGG 4 58 0 AACCATTGCG 0.988318 -112 GCTTCCGGCGTACCAGGGCGGTACGCGCGA 4 121 1 TACCAGGGCG 0.990954 -49 ********** Masking position 5 Map Score: 0.495191 Number of sites scoring better than the average of aligned sites = 68 Number in coding regions = 60 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 7 ACCGACACACGTTCCAGTCTCCTTAC 1 5 0 GTTCCATCTC 0.982077 -114 ACGTGTGTCGGTTACACCCGGCGTGTACGAGC 1 25 1 GTTACACCGC 0.981788 -94 CACCCGGCGTGTACGAGCCTTCTGGAAGAGGG 1 39 1 GTACGACCTC 0.976493 -80 CCTTAAAAAGGTTACATCCACCCTCTTCCAGA 1 59 0 GTTACACCAC 0.973174 -60 ACTGAGCGCTGATCCTACCTTCAGTT 3 5 0 GATCCTCCTC 0.963665 -92 GCGCTCGCGCGTACCGCCCTGGTACGCCGGAA 4 123 0 GTACCGCCTG 0.951473 -47 ****** *** * Masking position 9 Map Score: 0.430212 Number of sites scoring better than the average of aligned sites = 152 Number in coding regions = 127 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 8 ********** No masking Map Score: 6.06393e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 6.06393e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 6.06393e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0