AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -imetR_tpal_opreg_100.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP0284 104 T. pallidum predicted coding region TP0284 #2 TP0329 117 serine hydroxymethyltransferase (glyA) Motif number 1 ACTCAACCGAGTGAGAAAAAGAATCATCAC 1 29 0 GTGAGAAAAA 0.994213 -76 GATACCCGTCGTGCGTAACAGGGGAACATA 2 14 0 GTGCGTAACA 0.983834 -104 CATTCTTTGCGCTAGAAACAGAGCGAACAA 2 70 1 GCTAGAAACA 0.967611 -48 GCTAGAAACAGAGCGAACAATATTCTGCCT 2 80 1 GAGCGAACAA 0.988174 -38 CCTACCTGAGGAGAGAAAAAC 2 107 1 GAGAGAAAAA 0.994214 -11 ********** Masking position 7 Map Score: 5.88729 Number of sites scoring better than the average of aligned sites = 133 Number in coding regions = 122 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 AAGAATCATCACATACTCAGCTCATGCAAT 1 10 0 ACATACTCGC 0.982522 -95 GAACCTTGCTCAAAACTTTTCTGAACTTTAA 1 78 0 CAAAACTTTC 0.952902 -27 GCCGCATGCCCGATACCCGTCGTGCGTAACA 2 24 0 CGATACCCTC 0.967805 -94 AAAGAATGGACAAAACGCCGCGCGCCGCATG 2 47 0 CAAAACGCGC 0.987847 -71 GGCGTTTTGTCCATTCTTTGCGCTAGAAACA 2 59 1 CCATTCTTGC 0.968022 -59 ACAGAGCGAACAATATTCTGCCTACCTGAGG 2 87 1 CAATATTCGC 0.981145 -31 ******** ** Masking position 3 Map Score: 2.36365 Number of sites scoring better than the average of aligned sites = 437 Number in coding regions = 418 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 ATTGCATGAGCTGAGTATGTGATGA 1 4 1 GCATGGCGAG 0.995009 -101 CATGCCCGATACCCGTCGTGCGTAACAGGGGA 2 19 0 ACCCGCGGCG 0.994502 -99 CGGGTATCGGGCATGCGGCGCGCGGCGTTTTG 2 36 1 GCATGGGGCG 0.998791 -82 TATTCTGCCTACCTGAGGAGAGAAAAAC 2 100 1 ACCTGGGGAG 0.998113 -18 ***** ** *** Masking position 5 Map Score: 2.114 Number of sites scoring better than the average of aligned sites = 172 Number in coding regions = 160 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 CTCGGTTGAGTGATCTTCGGGGCTGTGCTT 1 48 1 TGATCTTCGG 0.981317 -57 TTTTGAGCAAGGTTCTCCTGC 1 94 1 GGTTCTCCTG 0.996057 -11 TGGTATGTTCCCCTGTTACGCACGA 2 6 1 TGTTCCCCTG 0.996057 -112 ********** Masking position 4 Map Score: 0.74781 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 35 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0