AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -iompR_tpal_opreg_100.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP0135 300 T. pallidum predicted coding region TP0135 Motif number 1 CAGAAACGCGGCTGCATGTTGGGCGCTAACGGG 1 12 1 GCGCATGTGG 0.94799 -289 GGTTTGAACCGCTGACCTCTTGGGTGTAAACCA 1 43 1 GCGACCTCGG 0.991157 -258 AGCTCAGCGGGCAGAGCGCTTGGTTTACACCCA 1 63 0 GCGAGCGCGG 0.998429 -238 TACGCAGGGCGCTTAGCTCAGCGGGCAGAGCGC 1 77 0 GCTAGCTCCG 0.953713 -224 TTGGTATGCGACCGCGCGCGACGCACAAGCGCG 1 115 1 ACGCGCGCCG 0.998372 -186 CGGTACAGGCACTGCGTGCACGGCGCGCTTGTG 1 138 0 ACGCGTGCGG 0.99884 -163 CAGTGCCTGTACCGCCTTCCATGATACCCCGAC 1 157 1 ACGCCTTCTG 0.984799 -144 TCGCGCTTGTGCGTCGCGCATGTCGGGGTATC 1 179 0 GCTCGCGCTG 0.992432 -122 CGGTACAGGCACTGCGTGCACGGTCGCGCTTGT 1 202 0 ACGCGTGCGG 0.99884 -99 CAGTGCCTGTACCGCCTTCCATGATACCCCGAC 1 221 1 ACGCCTTCTG 0.984799 -80 ATCGTGTTGCGCGCCGCGCAGTGTCGGGGTATC 1 243 0 GCCCGCGCTG 0.991009 -58 AACACGATGTACTGCATTCGGCGGCATGCCCAG 1 268 1 ACGCATTCCG 0.972006 -33 CCGCCGAGTCCTGGGCATGCCGCCG 1 286 0 GCGAGTCCGG 0.987039 -15 ** ****** ** Masking position 2 Map Score: 33.6224 Number of sites scoring better than the average of aligned sites = 1532 Number in coding regions = 1418 Number in noncoding regions = 114 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 2 AACGCGGCTGCATGTTGGGCGCTAACGGGTT 1 16 1 CATGTTGGCG 0.738987 -285 CTTAGCTCAGCGGGCAGAGCGCTTGGTTTAC 1 68 0 CGGGCAAGCG 0.931533 -233 ACCAAAACAATACGCAGGGCGCTTAGCTCAG 1 89 0 TACGCAGGCG 0.984389 -212 GCTTGTGCGTCGCGCGCGGTCGCATACCAAA 1 114 0 CGCGCGGGTC 0.983178 -187 ACAGGCACTGCGTGCACGGCGCGCTTGTGCG 1 136 0 CGTGCAGGCG 0.989102 -165 GTCGGGGTATCATGGAAGGCGGTACAGGCAC 1 159 0 CATGGAGGCG 0.988009 -142 GCTTGTGCGTCGCGCATGTCGGGGTATCAT 1 177 0 CGCGCATGTC 0.981834 -124 ACAGGCACTGCGTGCACGGTCGCGCTTGTGC 1 200 0 CGTGCAGGTC 0.994883 -101 GTCGGGGTATCATGGAAGGCGGTACAGGCAC 1 223 0 CATGGAGGCG 0.988009 -78 TGTTGCGCGCCGCGCAGTGTCGGGGTATCAT 1 241 0 CGCGCATGTC 0.97869 -60 CACTGCGCGGCGCGCAACACGATGTACTGCA 1 253 1 CGCGCACACG 0.583459 -48 CGCCGAGTCCTGGGCATGCCGCCGAATGCAG 1 279 0 TGGGCAGCCG 0.928667 -22 ****** **** Masking position 4 Map Score: 24.5274 Number of sites scoring better than the average of aligned sites = 1653 Number in coding regions = 1528 Number in noncoding regions = 125 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 3 GCAGAAACGCGGCTGCATGTT 1 2 1 CAGAAACGCG 0.991466 -299 GCATGTTGGGCGCTAACGGGTTTGAACCGC 1 25 1 CGCTAACGGG 0.982132 -276 GCGCGCGACGCACAAGCGCGCCGTGCACGC 1 128 1 CACAAGCGCG 0.995445 -173 GTGCGTCGCGCATGTCGGGGTATCATGGA 1 174 0 CATGTCGGG 0.89338 -127 STGCGCGACGCACAAGCGCGACCGTGCACG 1 191 1 CACAAGCGCG 0.995445 -110 GCGCGCCGCGCAGTGTCGGGGTATCATGGA 1 238 0 CAGTGTCGGG 0.989746 -63 ********** Masking position 7 Map Score: 9.58045 Number of sites scoring better than the average of aligned sites = 178 Number in coding regions = 168 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 AGCGCCCAACATGCAGCCGCGTTTCTGC 1 9 0 ATGCAGCCGC 0.992088 -292 TTGTTTTGGTATGCGACCGCGCGCGACGCA 1 110 1 ATGCGACCGC 0.996851 -191 ACCGCCTTCCATGATACCCCGACASTGCGC 1 167 1 ATGATACCCC 0.995883 -134 ACCGCCTTCCATGATACCCCGACACTGCGC 1 231 1 ATGATACCCC 0.995883 -70 ********** Masking position 2 Map Score: 5.98025 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 12 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0