AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -ioxyR_tpal_opreg_300.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP1038 226 bacterioferrin (TpF1) Motif number 1 CGTAATTCTCAATCCACCAAGCCTCCCAACAA 1 29 0 AATCCCAAGC 0.936248 -198 GAGAATTACGTCTCCTGGAAAAAAGATTTCGC 1 51 1 TCTCCGAAAA 0.978915 -176 GGAAAAAAGATTTCGCTGAAACTTCACGAAAT 1 67 1 TTTCGGAAAC 0.972367 -160 CTTCACGAAATCTCGGTGAAAATAAATGATTA 1 88 1 TCTCGGAAAA 0.980064 -139 TTATTTTACCAATCGGTGAAAAAAAGCCGGGA 1 117 1 AATCGGAAAA 0.982502 -110 CGGTGAAAAAAAGCCGGGAAAAGTCCAAAAAG 1 130 1 AAGCCGAAAA 0.98112 -97 AGCAAAAACCATGCCAACAAAAAATCGAAAGA 1 181 0 ATGCCCAAAA 0.957006 -46 CGTTCTTTCTCCTCCAAACTTTAAAGCAA 1 208 0 TCTCCCAAAC 0.987988 -19 ***** ***** Masking position 9 Map Score: 10.2727 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 118 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 AAGCCTCCCAACAAACCGGTAAGATCATTG 1 13 0 ACAAACCGGT 0.991501 -214 TGATTATTTTACCAATCGGTGAAAAAAAGC 1 114 1 ACCAATCGGT 0.91445 -113 ATCGGTGAAAAAAAGCCGGGAAAAGTCCAA 1 128 1 AAAAGCCGGG 0.994412 -99 GAAAAGTCCAAAAAGACAGTGGTTATGCTC 1 147 1 AAAAGACAGT 0.949485 -80 ACTTTAAAGCAAAAACCATGCCAACAAAAA 1 190 0 AAAAACCATG 0.934714 -37 ********** Masking position 4 Map Score: 1.93006 Number of sites scoring better than the average of aligned sites = 180 Number in coding regions = 163 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 ********** No masking Map Score: 3.36387e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 3.36387e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.36387e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0