AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -isoxS_tpal_opreg_300.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP0135 300 T. pallidum predicted coding region TP0135 #2 TP0478 72 glucose-6-phosphate 1-dehydrogenase (zwf) #3 TP0479 111 T. pallidum predicted coding region TP0479 Motif number 1 CCCAACATGCAGCCGCGTTTCTGC 1 1 0 AGCCGGTTGC 0.871041 -300 CAAACCCGTTAGCGCCCAACATGCAGCCGCGTTT 1 15 0 AGCGCCATGC 0.99444 -286 GTGTAAACCAAGCGCTCTGCCCGCTGAGCTAAGC 1 66 1 AGCGCCTCGC 0.997485 -235 TTGGTATGCGACCGCGCGCGACGCACAAGCGCGC 1 115 1 ACCGCCGCGC 0.997976 -186 ACAGGCACTGCGTGCACGGCGCGCTTGTGCGTCG 1 133 0 CGTGCCGCGC 0.994857 -168 CCGTGCACGCAGTGCCTGTACCGCCTTCCATGAT 1 148 1 AGTGCTGCGC 0.972624 -153 TTCCATGATACCCCGACASTGCGCGACGCACAAG 1 173 1 CCCCGCACGC 0.990882 -128 CAAGCGCGACCGTGCACGCAGTGCCTGTACCGCC 1 203 1 CGTGCCGTGC 0.986564 -98 CAGTGCCTGTACCGCCTTCCATGATACCCCGACA 1 221 1 ACCGCTTTGA 0.752838 -80 TTCCATGATACCCCGACACTGCGCGGCGCGCAAC 1 237 1 CCCCGCACGC 0.990882 -64 GACACTGCGCGGCGCGCAACACGATGTACTGCAT 1 251 1 GGCGCCACGA 0.916572 -50 CCGCCGAGTCCTGGGCATGCCGCCGAATGCAGT 1 278 0 CCTGGCACGC 0.9855 -23 TGCCTTAGGGAGCGGAGAGTCTGCCTGCGGCACA 2 11 1 AGCGGGATGC 0.958934 -62 TGCGACCTACACCGGATGTGCCGCAGGCAGACTC 2 27 0 ACCGGTGCGC 0.986998 -46 AACTTGACGGCGCGCGCTAAACGCCTAATAATTG 3 41 0 CGCGCCTCGC 0.998217 -71 GCCCTCCCCCCTTCCTTGCGAAGAGGAGT 3 93 0 CCCCCTTTGC 0.936761 -19 ***** ** *** Masking position 13 Map Score: 33.9475 Number of sites scoring better than the average of aligned sites = 3364 Number in coding regions = 3114 Number in noncoding regions = 250 Number of orfs with sites within 600 bp upstream = 132 Fraction of orfs with sites within 600 bp upstream = 0.0212014 Motif number 2 ACGCGGCTGCATGTTGGGCGCTAACGGGTTT 1 17 1 ATGTGGGCGC 0.971868 -284 TTGGGTGTAAACCAAGCGCTCTGCCCGCTGA 1 62 1 ACCAGCGCTC 0.871221 -239 AGGGCGCTTAGCTCAGCGGGCAGAGCGCTTG 1 74 0 GCTCGCGGGC 0.96947 -227 CCAAAACAATACGCAGGGCGCTTAGCTCAGC 1 88 0 ACGCGGGCGC 0.988072 -213 GCGCGCTTGTGCGTCGCGCGCGGTCGCATAC 1 118 0 GCGTGCGCGC 0.548046 -183 GCACAAGCGCGCCGTGCACGCAGTGCCTGTA 1 137 1 GCCGGCACGC 0.993269 -164 GGTCGCGCTTGTGCGTCGCGCATGTCGGGG 1 183 0 GTGCTCGCGC 0.724035 -118 CACAAGCGCGACCGTGCACGCAGTGCCTGTA 1 201 1 ACCGGCACGC 0.985602 -100 CCCCGACACTGCGCGGCGCGCAACACGATGT 1 247 1 GCGCGCGCGC 0.507656 -54 TCGGCGGCATGCCCAGGACTCGGCGG 1 285 1 GCCCGGACTC 0.949922 -16 TACACCGGATGTGCCGCAGGCAGACTCTCCG 2 23 0 GTGCGCAGGC 0.936667 -50 GGCACATCCGGTGTAGGTCGCACCGTTGAAA 2 39 1 GTGTGGTCGC 0.894746 -34 GAAAAACTTGACGGCGCGCGCTAAACGCCTA 3 48 0 ACGGGCGCGC 0.99284 -64 **** ****** Masking position 11 Map Score: 32.5461 Number of sites scoring better than the average of aligned sites = 2304 Number in coding regions = 2124 Number in noncoding regions = 180 Number of orfs with sites within 600 bp upstream = 105 Fraction of orfs with sites within 600 bp upstream = 0.0168648 Motif number 3 GCAGAAACGCGGCTGCATGTTGGGC 1 5 1 AAACCGGCTG 0.843979 -296 TTACACCCAAGAGGTCAGCGGTTCAAACCCG 1 41 0 GAGGCAGCGG 0.950117 -260 TCTTGGGTGTAAACCAAGCGCTCTGCCCGCT 1 60 1 AAACAAGCGC 0.938306 -241 TCTGCCCGCTGAGCTAAGCGCCCTGCGTATT 1 81 1 GAGCAAGCGC 0.932235 -220 TCGCATACCAAAACAATACGCAGGGCGCTTA 1 95 0 AAACATACGC 0.594758 -206 GTATGCGACCGCGCGCGACGCACAAGCGCGC 1 118 1 GCGCCGACGC 0.917841 -183 CAGGCACTGCGTGCACGGCGCGCTTGTGCGT 1 135 0 GTGCCGGCGC 0.990777 -166 TCGGGGTATCATGGAAGGCGGTACAGGCACT 1 158 0 ATGGAGGCGG 0.98333 -143 TACCCCGACASTGCGCGACGCACAAGCGCGA 1 181 1 STGCCGACGC 0.981446 -120 CGCGACGCACAAGCGCGACCGTGCACGCAGT 1 194 1 AAGCCGACCG 0.863999 -107 TCGGGGTATCATGGAAGGCGGTACAGGCACT 1 222 0 ATGGAGGCGG 0.98333 -79 TACCCCGACACTGCGCGGCGCGCAACACGAT 1 245 1 CTGCCGGCGC 0.963234 -56 GGCATGCCCAGGACTCGGCGG 1 290 1 GGACCGGCGG 0.933874 -11 CGCACCGTTGAAAGAAGGGGCGGTTT 2 57 1 AAAGAGGGGC 0.847647 -16 GCCTTTAGAAAAAGGAGGAGCTC 3 3 0 AAAGAGGAGC 0.671028 -109 ACGGTGAGAAAAACTTGACGGCGCGCGCTAA 3 55 0 AAACTGACGG 0.772343 -57 GAAGAGGAGTATGCCAAACGGTGAGAAAAAC 3 72 0 ATGCAAACGG 0.880682 -40 TCCTCTTCGCAAGGAAGGGGGGAGGGC 3 95 1 AAGGAGGGGG 0.932867 -17 **** ****** Masking position 10 Map Score: 26.54 Number of sites scoring better than the average of aligned sites = 2634 Number in coding regions = 2416 Number in noncoding regions = 218 Number of orfs with sites within 600 bp upstream = 155 Fraction of orfs with sites within 600 bp upstream = 0.0248956 Motif number 4 CGCGGTCGCATACCAAAACAATACGCAGGG 1 101 0 TACCAAAACA 0.953443 -200 CCTTCCATGATACCCCGACASTGCGCGACG 1 171 1 TACCCCGACA 0.997503 -130 CCTTCCATGATACCCCGACACTGCGCGGCG 1 235 1 TACCCCGACA 0.997503 -66 ********** Masking position 8 Map Score: 2.22308 Number of sites scoring better than the average of aligned sites = 11 Number in coding regions = 8 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 CCTCTTGGGTGTAAACCAAGCGCTCTGCCC 1 58 1 GTAAACCAAG 0.965942 -243 GCGCGCGGTCGCATACCAAAACAATACGCA 1 104 0 GCATACCAAA 0.986238 -197 GCATTCGGCGGCATGCCCAGGACTCGGCGG 1 281 1 GCATGCCCAG 0.990154 -20 GCGAAGAGGAGTATGCCAAACGGTGAGAAA 3 75 0 GTATGCCAAA 0.986226 -37 ********** Masking position 3 Map Score: 1.93104 Number of sites scoring better than the average of aligned sites = 30 Number in coding regions = 25 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 6 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0