AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -icynR_ecoli_hinf_100.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 cynR_cynT 108 cynR: cyn operon positive regulator, cynT: carbonic anhydrase #2 cynS 30 cyanate aminohydrolase, cyanase #3 cynX 32 cyanate transport #4 HI0775 205 transcriptional regulator Motif number 1 TGAGTTCCATTGGATTTACTTATAGGTTGCG 1 87 1 TGGATTACTT 0.855611 -22 CGTGAACGTCTTTTGATGGTTGC 3 20 0 TGAAGTCTTT 0.982265 -13 ACTTATTTGTTGATATTCTTTCTTTTAATCT 4 29 0 TGATTTCTTT 0.977363 -177 ATATTTCAAATGGATATGTTTCTTGCGATGA 4 65 1 TGGAATGTTT 0.895008 -141 ATGTTTCTTGCGATGATCCTTGATAGGCAAT 4 80 1 CGATATCCTT 0.883354 -126 TTAATATCAATCTAGTTCCTTTATTGCCTAT 4 102 0 TCTATTCCTT 0.811012 -104 ATTTCTTTTACGAAATTCTTTTTGCTATTTT 4 132 0 CGAATTCTTT 0.975747 -74 CTAAGAAAGATGTATTTCTTTTACGAAATTC 4 145 0 TGTATTCTTT 0.972831 -61 TAAGTTATTTTGATAGTGTTTTAAACAATCC 4 183 1 TGATGTGTTT 0.91134 -23 **** ****** Masking position 7 Map Score: 5.37307 Number of sites scoring better than the average of aligned sites = 844 Number in coding regions = 710 Number in noncoding regions = 134 Number of orfs with sites within 600 bp upstream = 155 Fraction of orfs with sites within 600 bp upstream = 0.0248956 Motif number 2 AAATCCAATGGAACTCATCATAAATGAGACT 1 73 0 GAACTCATAT 0.992633 -36 GGTGGAACTCCTGATGGTTTAAAAA 2 16 0 GAACTCCTAT 0.997286 -15 AGAGACCTCCTAATAACGAGATTA 4 4 1 GACCTCCTAT 0.996773 -202 ******** ** Masking position 2 Map Score: 2.19283 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 4 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 TCGCAACCTATAAGTAAATCCAATGG 1 93 0 CCTATAAGTA 0.841781 -16 CCTTATTTTTAAACCATCAGG 2 2 1 CTTATTTTTA 0.968619 -29 TTTTAATCTCGTTATTAGGAGGTCTCT 4 8 0 GTTATTAGGA 0.955685 -198 ATATAAGATACTTATTTGTTGATATTCTTT 4 39 0 CTTATTTGTT 0.922921 -167 AATTCTTTTTGCTATTTTTAATATCAATCT 4 120 0 GCTATTTTTA 0.962391 -86 GCGGGTATAAGTTATTTTGATAGTGTTTTA 4 176 1 GTTATTTTGA 0.962391 -30 ********** Masking position 5 Map Score: 1.8663 Number of sites scoring better than the average of aligned sites = 208 Number in coding regions = 151 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 4 ACTACTCGCCGATTGTCATAAGGTAAAAGTCT 1 46 1 GATGCATAAG 0.96045 -63 TGGAACTCCTGATGGTTTAAAAATAAGG 2 7 0 GATGTTAAAA 0.980368 -24 GATGATCCTTGATAGGCAATAAAGGAACTAGA 4 91 1 GATGCAATAA 0.981788 -115 AAAGGAACTAGATTGATATTAAAAATAGCAAA 4 111 1 GATGTATTAA 0.972107 -95 AAGGATTGTTTAAAACACTATCAAA 4 191 0 GATGTTAAAA 0.980368 -15 *** * ****** Masking position 3 Map Score: 1.58911 Number of sites scoring better than the average of aligned sites = 126 Number in coding regions = 116 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 CGTTAACCTCTGTCTGTCTCT 1 2 1 GTTAACCTCT 0.981321 -107 GTTAACCTCTGTCTGTCTCTGGAATGAGAG 1 12 1 GTCTGTCTCT 0.982391 -97 TCGGCGAGTAGTCTGCCTCTCATTCCAGAG 1 28 0 GTCTGCCTCT 0.995509 -81 CGTGAACGTCTTTTGATGGTT 3 22 0 GTGAACGTCT 0.966718 -11 ********** Masking position 8 Map Score: 1.68569 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 95 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 6 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0