AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -imarR_ecoli_hinf_100.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 marR 268 multiple antibiotic resistance protein; repressor of mar operon #2 marB 31 multiple antibiotic resistance protein Motif number 1 CCTTGTTTACCCCTTATACTTTTCGCTGATAACC 1 36 0 CCTTACTTTC 0.928446 -233 AACAAGGATAAAGTGTCACTCTTTAGCTAGCCTT 1 63 1 AATGACTTTT 0.937775 -206 CTTTAGCTAGCCTTGCATCGCATTGAACAAAACT 1 83 1 CCTGTCGATT 0.961865 -186 ATTGAACAAAACTTGAACCGATTTAGCAAAACGT 1 104 1 ACTGCCGTTT 0.929494 -165 ATGAATTGACCGATGCCACGTTTTGCTAAATCGG 1 121 0 CGTGACGTTT 0.995446 -148 CAATATTATCCCCTGCAACTAATTACTTGCCAGG 1 179 1 CCTGACTATT 0.980412 -90 TTGAACAGATCGCTGGTACTTTTCACATTAGTTG 1 214 0 CGTGACTTTC 0.991234 -55 GCGATCTGTTCAATGAAATTATTCCATTGGGTCG 1 235 1 CATGATTTTC 0.862681 -34 GAAATTATTCCATTGGGTCGCTTAATCCAT 1 249 1 CATGTCGTTA 0.901193 -20 GCCTCAGTGACGTTGTCACGTTTTCAA 2 4 0 CGTGACGTTT 0.995446 -28 ** ** *** *** Masking position 4 Map Score: 11.6618 Number of sites scoring better than the average of aligned sites = 1156 Number in coding regions = 1059 Number in noncoding regions = 97 Number of orfs with sites within 600 bp upstream = 113 Fraction of orfs with sites within 600 bp upstream = 0.0181497 Motif number 2 AGGATAAAGTGTCACTCTTTAGCTAGCCTT 1 67 1 GTCACTCTTT 0.878281 -202 GCTAAATCGGTTCAAGTTTTGTTCAATGCG 1 101 0 TTCAAGTTTT 0.857466 -168 ATTGACCGATGCCACGTTTTGCTAAATCGG 1 121 0 GCCACGTTTT 0.966543 -148 CGTGGCATCGGTCAATTCATTCATTTGACT 1 135 1 GTCAATTCAT 0.897636 -134 ATATTGCCCAGGCAAGTATAAGTCAAATGA 1 155 0 GGCAAGTATA 0.904602 -114 TAGTTGCCCTGGCAAGTAATTAGTTGCAGG 1 190 0 GGCAAGTAAT 0.979927 -79 TACTTGCCAGGGCAACTAATGTGAAAAGTA 1 202 1 GGCAACTAAT 0.917997 -67 ATTCCATTGGGTCGCTTAATCCAT 1 255 1 GTCGCTTAAT 0.854147 -14 CAGTGACGTTGTCACGTTTTCAA 2 4 0 GTCACGTTTT 0.987497 -28 ********** Masking position 3 Map Score: 6.30526 Number of sites scoring better than the average of aligned sites = 1415 Number in coding regions = 1225 Number in noncoding regions = 190 Number of orfs with sites within 600 bp upstream = 196 Fraction of orfs with sites within 600 bp upstream = 0.0314809 Motif number 3 TGCATCGCATTGAACAAAACTTGAACCGAT 1 96 1 TGAACAAAAC 0.9919 -173 TTGAACCGATTTAGCAAAACGTGGCATCGG 1 116 1 TTAGCAAAAC 0.947585 -153 GCAACTAATGTGAAAAGTACCAGCGATCTG 1 213 1 TGAAAAGTAC 0.949667 -56 ATAATTTCATTGAACAGATCGCTGGTACTT 1 227 0 TGAACAGATC 0.986836 -42 ********** Masking position 6 Map Score: 0.989314 Number of sites scoring better than the average of aligned sites = 261 Number in coding regions = 230 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 4 AAGAGTGACACTTTATCCTTGTTTACCCCT 1 56 0 CTTTATCCTT 0.959079 -213 GCATCGGTCAATTCATTCATTTGACTTATA 1 139 1 ATTCATTCAT 0.922641 -130 GTTCAATGAAATTATTCCATTGGGTCGCTT 1 242 1 ATTATTCCAT 0.963415 -27 CATTGGGTCGCTTAATCCAT 1 259 1 CTTAATCCAT 0.989987 -10 ********** Masking position 6 Map Score: 0.519338 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 115 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 5 TGGTGGTTGTTATCCTGTGTATCTGGG 1 8 1 TGTTATCCTG 0.966283 -261 TACTTTTCGCTGATAACCCAGATACACAGG 1 24 0 TGATAACCCA 0.967768 -245 ACTTTATCCTTGTTTACCCCTTATACTTTT 1 47 0 TGTTTACCCC 0.988062 -222 GCCTGGGCAATATTATCCCCTGCAACTAAT 1 172 1 TATTATCCCC 0.981384 -97 ********** Masking position 4 Map Score: 0.263181 Number of sites scoring better than the average of aligned sites = 293 Number in coding regions = 247 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 6 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0