AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00150_aquae_reg_100.orf -o00150_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 aq_260 300 hypothetical protein #2 aq_1510 113 putative protein #3 carB2 26 carbamoyl-phosphate synthase large subunit Motif number 1 AACAACTTATGAGTTTTCCACAATTCTCCA 1 12 0 GAGTTTTCCA 0.949749 -289 GAAAACTCATAAGTTGTTCATATAACGACA 1 24 1 AAGTTGTTCA 0.992919 -277 TTTTTAACGTAAGTAGTTTATACACCGTGG 1 73 0 AAGTAGTTTA 0.813273 -228 ATAACTTAAGAAGTTTTCCACATTTATCCA 1 105 0 AAGTTTTCCA 0.990999 -196 AAAACTTCTTAAGTTATTCATACTACGAAA 1 118 1 AAGTTATTCA 0.984185 -183 TGAACAACTTAAGTTATTTATAATTCGTAA 1 167 0 AAGTTATTTA 0.932147 -134 TAAATAACTTAAGTTGTTCATGTGGAAAAG 1 177 1 AAGTTGTTCA 0.992919 -124 AACTTTCCACAACTTTTCCACATGAACAAC 1 189 0 AACTTTTCCA 0.927835 -112 AAGTTGTGGAAAGTTTTTCGGGAAAAGCTT 1 204 1 AAGTTTTTCG 0.971271 -97 ATGGGTTTTGAAATTTGTCACATGAAAATA 1 242 1 AAATTTGTCA 0.843206 -59 CATTTTGAAGAAGTGTGTCAAGTTAATTTA 2 44 1 AAGTGTGTCA 0.963228 -70 AAAAATCAAAAAGTGTTTTAAATTAACTTG 2 62 0 AAGTGTTTTA 0.943455 -52 ********** Masking position 2 Map Score: 22.1729 Number of sites scoring better than the average of aligned sites = 592 Number in coding regions = 553 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 AACTTATGAGTTTTCCACAATTCTCCAC 1 9 0 TTTTCCACAA 0.975518 -292 AACTCATAAGTTGTTCATATAACGACACAA 1 27 1 TTGTTCATAT 0.925215 -274 TTTTCCACATTTATCCACATTTTTAACGTA 1 92 0 TTATCCACAT 0.990303 -209 ACTTAAGAAGTTTTCCACATTTATCCACAT 1 102 0 TTTTCCACAT 0.99222 -199 ACTTCTTAAGTTATTCATACTACGAAACAA 1 121 1 TTATTCATAC 0.880212 -180 TTTCCACAACTTTTCCACATGAACAACTTA 1 186 0 TTTTCCACAT 0.99222 -115 TCCCGAAAAACTTTCCACAACTTTTCCACA 1 197 0 CTTTCCACAA 0.893761 -104 GGTTTTGAAATTTGTCACATGAAAATAGCC 1 245 1 TTTGTCACAT 0.943504 -56 CCGCCTATTATTATTCTTATTAATACAAAA 1 273 1 TTATTCTTAT 0.796039 -28 GAGTGTAATTTTATTCATTTTGAAGAAGTG 2 29 1 TTATTCATTT 0.79604 -85 ********** Masking position 2 Map Score: 14.2117 Number of sites scoring better than the average of aligned sites = 365 Number in coding regions = 323 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 3 ACATTTATCCACATTTTTAACGTAAGTAGTT 1 85 0 ACATTTTAAC 0.959807 -216 TTATAATTCGTAAGTTTTAAGTCACCGGATT 1 149 0 TAAGTTTAAG 0.920896 -152 CAAAACCCATTGATTTTCAAGCTTTTCCCGA 1 221 0 TGATTTTAAG 0.976101 -80 GTAATTTTATTCATTTTGAAGAAGTGTGTCA 2 33 1 TCATTTTAAG 0.976101 -81 TGTGTCAAGTTAATTTAAAACACTTTTTGAT 2 57 1 TAATTTAAAC 0.926095 -57 TTACCTCTAGAGATTTATAACAAAAATCAAA 2 82 0 AGATTTAAAC 0.912193 -32 TCTAGAGGTAAAATCTTTAAGT 2 102 1 AAATCTTAAG 0.899402 -12 ******* *** Masking position 3 Map Score: 3.11635 Number of sites scoring better than the average of aligned sites = 206 Number in coding regions = 169 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 4 CTCATAAGTTGTTCATATAACGACACAATC 1 29 1 GTTCATATAA 0.902061 -272 AACGTAAGTAGTTTATACACCGTGGTTTTC 1 68 0 GTTTATACAC 0.909479 -233 AGTTTTCCACATTTATCCACATTTTTAACG 1 94 0 ATTTATCCAC 0.91365 -207 TTCTTAAGTTATTCATACTACGAAACAATC 1 123 1 ATTCATACTA 0.953166 -178 TATTATTCTTATTAATACAAAATAAATAGT 1 281 1 ATTAATACAA 0.932962 -20 CTCACTGTTTATACTATATACTTTAA 3 7 1 GTTTATACTA 0.967136 -20 ********** Masking position 5 Map Score: 2.77574 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 74 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 TTTTCTTTTGAGTAGATTGTGTCGTTATAT 1 43 0 AGTAGATTGT 0.991162 -258 TTTTAACGTAAGTAGTTTATACACCGTGGT 1 72 0 AGTAGTTTAT 0.905461 -229 ATTAATACAAAATAAATAGT 1 291 1 AATAAATAGT 0.642568 -10 CTCCTCCGAAAGTAGAGTGTAATTTTATTC 2 15 1 AGTAGAGTGT 0.989682 -99 TTCATTTTGAAGAAGTGTGTCAAGTTAATT 2 42 1 AGAAGTGTGT 0.926985 -72 TTAAAGTATATAGTATAAACAGTG 3 13 0 AGTATATAGT 0.908238 -14 ********** Masking position 4 Map Score: 3.02434 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 83 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 6 ACTCATAAGTTGTTCATATAACGACACAAT 1 28 1 TGTTCATATA 0.85594 -273 TACACCGTGGTTTTCTTTTGAGTAGATTGT 1 53 0 TTTTCTTTTG 0.931653 -248 TAACTTAAGTTGTTCATGTGGAAAAGTTGT 1 181 1 TGTTCATGTG 0.984707 -120 TAGGCGGCTATTTTCATGTGACAAATTTCA 1 250 0 TTTTCATGTG 0.983511 -51 AGTGTAATTTTATTCATTTTGAAGAAGTGT 2 30 1 TATTCATTTT 0.90659 -84 TTAAAACACTTTTTGATTTTTGTTATAAAT 2 71 1 TTTTGATTTT 0.849006 -43 ********** Masking position 4 Map Score: 2.43086 Number of sites scoring better than the average of aligned sites = 103 Number in coding regions = 96 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 7 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 9.48026e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0