AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00040_bbur_reg_100.orf -o00040_bbur_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 BB0207 52 UTP--glucose-1-phosphate uridylyltransferase (gtaB) #2 BB0544 202 phosphoribosyl pyrophosphate synthetase (prs) Motif number 1 TGAATATATAAAATTAAATTTTT 1 4 1 ATATATAAAA 0.95194 -49 AAATAAGATTATAGCAAAAATTTAATTTTA 1 19 0 ATAGCAAAAA 0.960867 -34 ACATAATCCTAAAAATAAAATTAAATAAA 2 10 0 AAAAATAAAA 0.968954 -193 AGCAAAAACAAATACTATAACATAATCCTA 2 29 0 AATACTATAA 0.880578 -174 AATTCTATTAATAGCAAAAACAAATACTAT 2 41 0 ATAGCAAAAA 0.960867 -162 ATAAAAATAAAAATCTAAAAATTCTATTAA 2 60 0 AAATCTAAAA 0.981462 -143 TTTTAGCTTTAATAATAAAAATAAAAATCT 2 74 0 AATAATAAAA 0.955161 -129 TTTTATTATTAAAGCTAAAATATTTTAATG 2 84 1 AAAGCTAAAA 0.988134 -119 ACACACAAATATGACTAAAATTTTTTAAAG 2 120 0 ATGACTAAAA 0.968813 -83 TAATTTACTAATTAATAAAACTTATACACA 2 145 0 ATTAATAAAA 0.960584 -58 ATTGTTAAGATTTTCTAAAAAAGAACGAGG 2 177 1 TTTTCTAAAA 0.795961 -26 ********** Masking position 7 Map Score: 18.7684 Number of sites scoring better than the average of aligned sites = 1280 Number in coding regions = 815 Number in noncoding regions = 465 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 2 TGAATATATAAAATTAAATTTTTGCTATAA 1 11 1 AAATTAAATT 0.891739 -42 TTTCTCTCTTAAAATAAGATTATAGCAAAA 1 30 0 AAAATAAGAT 0.984821 -23 CATAATCCTAAAAATAAAATTAAATAAA 2 9 0 AAAATAAAAT 0.987351 -194 ATTAATAGCAAAAACAAATACTATAACATA 2 35 0 AAAACAAATA 0.892767 -168 TTTAATAATAAAAATAAAAATCTAAAAATT 2 67 0 AAAATAAAAA 0.976995 -136 ATTAATTAGTAAATTAAGATTGTTAAGATT 2 159 1 AAATTAAGAT 0.96858 -44 ********** Masking position 6 Map Score: 8.81805 Number of sites scoring better than the average of aligned sites = 1050 Number in coding regions = 679 Number in noncoding regions = 371 Number of orfs with sites within 600 bp upstream = 109 Fraction of orfs with sites within 600 bp upstream = 0.0175072 Motif number 3 AAAATTTAATTTTATATATTCA 1 3 0 TTTATATATT 0.737987 -50 ATATATAAAATTAAATTTTTGCTATAATCT 1 14 1 TTAAATTTTT 0.912844 -39 CTCTCTTAAAATAAGATTATAGCAAAAATT 1 27 0 ATAAGATTAT 0.762638 -26 TTTATTTAATTTTATTTTTAGGATT 2 6 1 TTAATTTTAT 0.701267 -197 AATTTTATTTTTAGGATTATGTTATAGTAT 2 18 1 TTAGGATTAT 0.936862 -185 TTTGCTATTAATAGAATTTTTAGATTTTTA 2 53 1 ATAGAATTTT 0.882189 -150 AGCAAGGTCATTAAAATATTTTAGCTTTAA 2 92 0 TTAAAATATT 0.962969 -111 TGACCTTGCTTTAAAAAATTTTAGTCATAT 2 112 1 TTAAAAAATT 0.878846 -91 GTTTTATTAATTAGTAAATTAAGATTGTTA 2 154 1 TTAGTAAATT 0.798658 -49 ATTAAGATTGTTAAGATTTTCTAAAAAAGA 2 171 1 TTAAGATTTT 0.978664 -32 ********** Masking position 2 Map Score: 9.32309 Number of sites scoring better than the average of aligned sites = 3227 Number in coding regions = 2100 Number in noncoding regions = 1127 Number of orfs with sites within 600 bp upstream = 190 Fraction of orfs with sites within 600 bp upstream = 0.0305172 Motif number 4 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0