AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00440_bbur_reg_300.orf -o00440_bbur_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 BB0590 36 dimethyladenosine transferase (ksgA) #2 BB0591 115 competence locus E, putative Motif number 1 AATAATTTTAAAATATCTGT 1 1 1 AATAATTTTA 0.707546 -36 ATTATTCTTAATAATGACAG 1 27 0 ATTATTCTTA 0.971841 -10 ATTGTAATTAAATAATTATTAATTGTCAAC 2 16 1 AATAATTATT 0.499263 -100 TTAATCAATCAATAATCATTCGTTGACAAT 2 37 0 AATAATCATT 0.675647 -79 TTATTGATTGATTAATCAAAACAAATTAAA 2 52 1 ATTAATCAAA 0.942618 -64 AAAACAAATTAAAATTCAAAATATAATTAT 2 69 1 AAAATTCAAA 0.861916 -47 TTTATTTATAAATAATTATATTTTGAATTT 2 80 0 AATAATTATA 0.551709 -36 TATTCTTATTTTTATTTATAAATAATTATA 2 90 0 TTTATTTATA 0.755826 -26 TTATAATATTCTTATTTTTATTTA 2 102 0 AATATTCTTA 0.984463 -14 ********** Masking position 6 Map Score: 15.8414 Number of sites scoring better than the average of aligned sites = 1131 Number in coding regions = 745 Number in noncoding regions = 386 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 2 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0