AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00460_bbur_reg_100.orf -o00460_bbur_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 BB0599 51 cysteinyl-tRNA synthetase (cysS) #2 BB0620 226 beta-glucosidase, putative Motif number 1 AAAAAATCTAATTTATTATTAAGTACGT 1 9 0 ATTTATTATT 0.981343 -43 AATAAATTAGATTTTTTATTTTTTCAATTT 1 22 1 ATTTTTTATT 0.984376 -30 CATCAGCTTAAACTTTTATTAAGTGTATAA 2 91 1 AACTTTTATT 0.959696 -136 AACATTGACAAAGCATTATTGAATTTATAC 2 115 0 AAGCATTATT 0.918764 -112 TATTATTCAAAAGTATTATTATAAAGTATA 2 144 1 AAGTATTATT 0.974323 -83 TTAGCAAGCCATTTTGTATTATACTTTATA 2 163 0 ATTTTGTATT 0.953325 -64 CTAATTTAGTAATTTATATTTATTAGCAAG 2 185 0 AATTTATATT 0.912951 -42 CTAAATTAGCATTTATTATTTATATGGTTA 2 206 1 ATTTATTATT 0.981343 -21 ********** Masking position 8 Map Score: 13.5469 Number of sites scoring better than the average of aligned sites = 894 Number in coding regions = 556 Number in noncoding regions = 338 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 2 AAAAAATAAAAAATCTAATTTATTATTAAGTA 1 14 0 AAATCTATTA 0.915252 -38 TACAACCTCTAATGCTGATGGAGGGACTTGAA 2 12 1 AATGCTATGA 0.99399 -215 AATAAAAGTTTAAGCTGATGTAGCTCAGTTGG 2 79 0 TAAGCTATGA 0.956268 -148 TAAATTCAATAATGCTTTGTCAATGTTATTAT 2 118 1 AATGCTTGTA 0.953729 -109 ACTTTATAATAATACTTTTGAATAATAACATT 2 139 0 AATACTTTGA 0.944399 -88 ATAAATAATAAATGCTAATTTAGTAATTTATA 2 197 0 AATGCTATTA 0.99058 -30 ****** *** * Masking position 6 Map Score: 3.81682 Number of sites scoring better than the average of aligned sites = 197 Number in coding regions = 147 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 AATCTAATTTATTATTAAGTACGT 1 5 0 ATTATTAAGT 0.942226 -47 AGATTTTTTATTTTTTCAATTTTGAGAAAT 1 30 1 TTTTTTCAAT 0.909235 -22 ACATTTCTCAAAATTGAAAAAA 1 40 0 ATTTCTCAAA 0.891086 -12 AGCTTAAACTTTTATTAAGTGTATAAATTC 2 95 1 TTTATTAAGT 0.856651 -132 TTGACAAAGCATTATTGAATTTATACACTT 2 111 0 ATTATTGAAT 0.937506 -116 TTCAATAATGCTTTGTCAATGTTATTATTC 2 122 1 CTTTGTCAAT 0.724532 -105 TGTCAATGTTATTATTCAAAAGTATTATTA 2 135 1 ATTATTCAAA 0.965202 -92 ATTCAAAAGTATTATTATAAAGTATAATAC 2 148 1 ATTATTATAA 0.734186 -79 ATAAATATAAATTACTAAATTAGCATTTAT 2 192 1 ATTACTAAAT 0.947839 -35 ********** Masking position 6 Map Score: 5.96375 Number of sites scoring better than the average of aligned sites = 1486 Number in coding regions = 968 Number in noncoding regions = 518 Number of orfs with sites within 600 bp upstream = 116 Fraction of orfs with sites within 600 bp upstream = 0.0186315 Motif number 4 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0