AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00460_bbur_reg_300.orf -o00460_bbur_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 BB0599 51 cysteinyl-tRNA synthetase (cysS) #2 BB0620 226 beta-glucosidase, putative Motif number 1 ACGTACTTAATAATAAATTAGATTTTTT 1 9 1 AATAATAAAT 0.982073 -43 AAATTGAAAAAATAAAAAATCTAATTTATT 1 22 0 AATAAAAAAT 0.985334 -30 TTATACACTTAATAAAAGTTTAAGCTGATG 2 91 0 AATAAAAGTT 0.962288 -136 GTATAAATTCAATAATGCTTTGTCAATGTT 2 115 1 AATAATGCTT 0.923495 -112 TATACTTTATAATAATACTTTTGAATAATA 2 144 0 AATAATACTT 0.975527 -83 TATAAAGTATAATACAAAATGGCTTGCTAA 2 163 1 AATACAAAAT 0.956428 -64 CTTGCTAATAAATATAAATTACTAAATTAG 2 185 1 AATATAAATT 0.915871 -42 TAACCATATAAATAATAAATGCTAATTTAG 2 206 0 AATAATAAAT 0.982073 -21 ********** Masking position 4 Map Score: 13.5469 Number of sites scoring better than the average of aligned sites = 894 Number in coding regions = 556 Number in noncoding regions = 338 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 2 GTACTTAATAATAAATTAGATTTTTTATTTTT 1 13 1 ATATTAGATT 0.924979 -39 GTTCAAGTCCCTCCATCAGCATTAGAGGTTGT 2 13 0 CTATCAGCAT 0.995555 -214 ACCAACTGAGCTACATCAGCTTAAACTTTTAT 2 78 1 CTATCAGCTT 0.99365 -149 AGTAATTTATATTTATTAGCAAGCCATTTTGT 2 176 0 ATATTAGCAA 0.965543 -51 ATATAAATTACTAAATTAGCATTTATTATTTA 2 196 1 CTATTAGCAT 0.995209 -31 ** ******** Masking position 6 Map Score: 4.22858 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 39 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0