AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00650_bbur_reg_100.orf -o00650_bbur_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 BB0109 136 acetyl-CoA C-acetyltransferase (fadA) Motif number 1 CATTTTAGCTTGTTTATTAAATAATTCAGG 1 24 1 TGTTTATTAA 0.986512 -113 CAGGTTAAATAGTTTATTTTTATTAAATAA 1 50 1 AGTTTATTTT 0.990542 -87 ATAAAAACTAAGTTTATTTAATAAAAATAA 1 63 0 AGTTTATTTA 0.997106 -74 AAATAAACTTAGTTTTTATATGATCTATTG 1 74 1 AGTTTTTATA 0.969603 -63 TAATTCAATAAGTTTATTAAGACTTTAGGA 1 111 1 AGTTTATTAA 0.995861 -26 ********** Masking position 5 Map Score: 11.0481 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 42 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 ACAAGCTAAAATGTTATAATTTTAAA 1 6 0 ATGTATAATT 0.925581 -131 TAGCTTGTTTATTAAATAATTCAGGTTAAAT 1 29 1 ATTAATAATT 0.98213 -108 AATAATTCAGGTTAAATAGTTTATTTTTATT 1 43 1 GTTAATAGTT 0.971579 -94 AACTAAGTTTATTTAATAAAAATAAACTATT 1 57 0 ATTAATAAAA 0.804206 -80 GAATTATACAATACAATAGATCATATAAAAA 1 86 0 ATAAATAGAT 0.951125 -51 GTATTGTATAATTCAATAAGTTTATTAAGAC 1 103 1 ATTAATAAGT 0.976092 -34 *** ******* Masking position 6 Map Score: 5.13085 Number of sites scoring better than the average of aligned sites = 359 Number in coding regions = 228 Number in noncoding regions = 131 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0