AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00430_bsub_reg_300.orf -o00430_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ggt 184 gamma-glutamyltranspeptidase Motif number 1 TGCTATATTAGAATCAGCATACGGATTAAG 1 24 0 GAATCAGCAT 0.936946 -161 TGCTGATTCTAATATAGCACATGGCTCATA 1 35 1 AATATAGCAC 0.979096 -150 CAATATAATCAATTCTGCACAGAAAAACGG 1 66 1 AATTCTGCAC 0.948532 -119 TCTGCACAGAAAAACGGCATTATGCACTAT 1 79 1 AAAACGGCAT 0.975944 -106 TGCACTATATAATATACCATTTGTCACTTG 1 101 1 AATATACCAT 0.930464 -84 GCGTAAAAAAATTACAGCGTTTTCACAAGT 1 126 0 ATTACAGCGT 0.950909 -59 AGATTGTAACAATACAGCTTCATATAGGAG 1 158 1 AATACAGCTT 0.984347 -27 ********** Masking position 8 Map Score: 5.67903 Number of sites scoring better than the average of aligned sites = 2123 Number in coding regions = 1942 Number in noncoding regions = 181 Number of orfs with sites within 600 bp upstream = 168 Fraction of orfs with sites within 600 bp upstream = 0.0269836 Motif number 2 GTATGCTGATTCTAATATAGCACATGGCTC 1 32 1 TCTAATATAG 0.980376 -153 GTGCAGAATTGATTATATTGATATGAGCCA 1 56 0 GATTATATTG 0.979382 -129 ACAAATGGTATATTATATAGTGCATAATGC 1 95 0 TATTATATAG 0.969837 -90 ATTTTTTTACGCTAAGATTGTAACAATACA 1 144 1 GCTAAGATTG 0.978416 -41 ********** Masking position 5 Map Score: 2.36048 Number of sites scoring better than the average of aligned sites = 153 Number in coding regions = 118 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 ATAGCAGTCCCTTCTTAATCCGTAT 1 6 1 AGTCCCTTCT 0.995649 -179 ATATCAATATAATCAATTCTGCACAGAAAA 1 62 1 AATCAATTCT 0.93213 -123 ATATACCATTTGTCACTTGTGAAAACGCTG 1 112 1 TGTCACTTGT 0.982307 -73 GTTCTCCCTCCTATATGAAGCT 1 173 0 TCTCCCTCCT 0.986555 -12 ********** Masking position 7 Map Score: 0.777713 Number of sites scoring better than the average of aligned sites = 418 Number in coding regions = 303 Number in noncoding regions = 115 Number of orfs with sites within 600 bp upstream = 119 Fraction of orfs with sites within 600 bp upstream = 0.0191134 Motif number 4 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0