AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00473_bsub_reg_300.orf -o00473_bsub_300.ace -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ddlA 174 D-alanyl-D-alanine ligase A #2 ydcB 94 similar to holo- acyl-carrier protein synthase #3 ydcC 60 ydcC #4 dal 114 D-alanine racemase #5 yncD 300 similar to alanine racemase Motif number 1 TAATCCTAGACTTGTTTTCAATGGATACTCC 1 154 0 CTTGTTTTCA 0.951112 -21 TCCGAGCCCCTTTTCTTCATTTTGGTATAT 2 10 1 CTTTTCTTCT 0.964006 -85 ATGATTTGGCCTTTTTTTCGTTAGACATCGT 4 27 1 CTTTTTTTCT 0.978568 -88 CACTTCCTAGCTTTTATTCAATATCATTTAC 4 89 0 CTTTTATTCA 0.989624 -26 GTTTTGGGACATTTTTTTCTAAGGGTAGATG 5 41 0 ATTTTTTTCA 0.943673 -260 CCCGTACTTGCTATTATTCGAACATTGATAG 5 138 1 CTATTATTCA 0.944727 -163 ATTCGATCTTATTTTATTCAACTTTATTTGA 5 208 0 ATTTTATTCA 0.956169 -93 CAACAATTAACATTTATTCTTGCGGCAATAG 5 243 1 CATTTATTCT 0.914196 -58 ********* * Masking position 5 Map Score: 8.87145 Number of sites scoring better than the average of aligned sites = 425 Number in coding regions = 332 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 2 TATTTTATATTAAAATGGCATTGAAAAGGAG 1 20 0 TAAAAGGCAT 0.878305 -155 TAATATAAAATAAAAAGGAATTACATACAAA 1 39 1 TAAAAGGAAT 0.927248 -136 TTGGGCATGCTGATGTTGAATGCATTTGTAT 1 63 0 TGATGTGAAT 0.982647 -112 GATAAGATAGTAAAGATGAATTGTAGTGGGG 1 123 1 TAAAGTGAAT 0.972752 -52 CTCATATATTTGATAGTGCATTAAGGGAGAC 3 33 1 TGATATGCAT 0.952866 -28 GATATGTAAATGATATTGAATAAAAGCTAGG 4 84 1 TGATATGAAT 0.972752 -31 CACATGGATTTGCTGTTGAATGATTTCAAAT 5 183 1 TGCTGTGAAT 0.937657 -118 TGATTTCAAATAAAGTTGAATAAAATAAGAT 5 203 1 TAAAGTGAAT 0.972752 -98 ***** ***** Masking position 10 Map Score: 7.87629 Number of sites scoring better than the average of aligned sites = 313 Number in coding regions = 276 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 TTTTATTTTATATTAAAATGGCATTGAAAAG 1 23 0 TATAAAATGG 0.962543 -152 TTTAATATAAAATAAAAAGGAATTACATACA 1 37 1 AATAAAAGGA 0.821591 -138 ACTATAGATATACCAAAATGAAGAAAAGGGG 2 17 0 TACAAAATGA 0.986297 -78 GCGTACGTACTATTTAAATGGTTTGTCTCAT 2 57 0 TATTAAATGG 0.917891 -38 AAATAGTACGTACGCAAAGGAGGTTATCATA 2 73 1 TACCAAAGGA 0.937117 -22 TTACATATCATACTAAAATTAAAGGCTAAAG 4 62 0 TACAAAATTA 0.889243 -53 TTTAGTATGATATGTAAATGATATTGAATAA 4 76 1 TATTAAATGA 0.951787 -39 GACCGAGGATTACAAAAATGATTATTTGTTT 5 68 0 TACAAAATGA 0.986297 -233 *** ******* Masking position 6 Map Score: 7.04499 Number of sites scoring better than the average of aligned sites = 322 Number in coding regions = 244 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 4 GACTTGTTTTCAATGGATACTCCCCCCACT 1 147 0 CAATGGATAC 0.955676 -28 TCTGCATATTAGGGAAACCCCACTCATA 3 9 1 TTAGGGAAAC 0.960611 -52 GATAGTGCATTAAGGGAGACAAGTTGT 3 44 1 TAAGGGAGAC 0.988108 -17 ATTAAAGGCTAAAGGGAAACGATGTCTAAC 4 46 0 AAAGGGAAAC 0.96779 -69 AGTGGGGTGTTAATGGATGCGGCGACCGAG 5 92 0 TAATGGATGC 0.945949 -209 TAATAGCAAGTACGGGATACATGAGGCTTG 5 124 0 TACGGGATAC 0.981058 -177 ********** Masking position 7 Map Score: 4.23083 Number of sites scoring better than the average of aligned sites = 135 Number in coding regions = 102 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 CCAAATCATGTTTGGCCTTTGGCGG 4 6 0 TTTGGCCTTT 0.995926 -109 CCAAACATGATTTGGCCTTTTTTTCGTTAG 4 21 1 TTTGGCCTTT 0.995926 -94 ATCGTTTCCCTTTAGCCTTTAATTTTAGTA 4 53 1 TTTAGCCTTT 0.989416 -62 ********** Masking position 3 Map Score: 4.16071 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 29 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 CCGGAAAATGATCTAATTATTTTTGGGCAT 1 86 0 ATCTAATTAT 0.940464 -89 CATCTTTACTATCTTATCATTTTCACCGGA 1 111 0 ATCTTATCAT 0.961446 -64 ATAACGAGAAATCTAATCAGGAAATACTTA 5 11 0 ATCTAATCAG 0.9738 -290 GTCCCAAAACAAATAATCATTTTTGTAATC 5 62 1 AAATAATCAT 0.827749 -239 ATAAAATAAGATCGAATCATCCAACAATTA 5 222 1 ATCGAATCAT 0.973788 -79 ********** Masking position 6 Map Score: 1.36235 Number of sites scoring better than the average of aligned sites = 170 Number in coding regions = 140 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 7 AGATGAATTGTAGTGGGGGGAGTATCCATT 1 136 1 TAGTGGGGGG 0.993269 -39 TCAAATATATGAGTGGGGTTTCCCTAATAT 3 16 0 GAGTGGGGTT 0.989625 -45 TGAGGCTTGTAAGTGGGGTGTTAATGGATG 5 103 0 AAGTGGGGTG 0.994335 -198 ********** Masking position 2 Map Score: 0.361993 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 6 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 8 TTTGGGCATGCTGATGTTGAATGCATTTGT 1 65 0 CTGATGTTGA 0.925908 -110 TCATTTTCACCGGAAAATGATCTAATTATT 1 95 0 CGGAAAATGA 0.924167 -80 TCATTTTCCGGTGAAAATGATAAGATAGTA 1 105 1 GTGAAAATGA 0.963478 -70 TGATAAGATAGTAAAGATGAATTGTAGTGG 1 122 1 GTAAAGATGA 0.936961 -53 TGATATGTAAATGATATTGAATAAAAGCTA 4 83 1 ATGATATTGA 0.796404 -32 TTTTTTCTAAGGGTAGATGATAACGAGAAA 5 30 0 GGGTAGATGA 0.883878 -271 ATGATTTCAAATAAAGTTGAATAAAATAAG 5 202 1 ATAAAGTTGA 0.835151 -99 ********** Masking position 10 Map Score: 0.130579 Number of sites scoring better than the average of aligned sites = 1599 Number in coding regions = 1450 Number in noncoding regions = 149 Number of orfs with sites within 600 bp upstream = 153 Fraction of orfs with sites within 600 bp upstream = 0.0245744 Motif number 9 ********** No masking Map Score: 1.20325e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.20325e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.20325e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0