AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00471_ctra_reg_100.orf -o00471_ctra_100.ace -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 mraY 145 Muramoyl-Pentapeptide Transferase Motif number 1 GTAAAAGATCAGAATTTCTTTTTAGAATAG 1 11 1 AGAATTTCTT 0.993952 -135 AGTCGCTGTAAGATGCTCTTTTTAACTTGC 1 57 1 AGATGCTCTT 0.991358 -89 TTTAAGATAGAGAATTTCTTATAGGAGCTT 1 103 1 AGAATTTCTT 0.993952 -43 TTTTATTATGGGAAGCTCCTATAAGAAATT 1 115 0 GGAAGCTCCT 0.942498 -31 ********** Masking position 7 Map Score: 5.84474 Number of sites scoring better than the average of aligned sites = 110 Number in coding regions = 110 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 AGCGACTTGAAAGTTAACTATTTCTATTCT 1 34 0 AAGTTAACTA 0.800342 -112 TTCAAAAGGCAAGTTAAAAAGAGCATCTTA 1 65 0 AAGTTAAAAA 0.983998 -81 TCTTAAACTTAAGCTTTCAAAAGGCAAGTT 1 80 0 AAGCTTTCAA 0.959172 -66 TTGAAAGCTTAAGTTTAAGATAGAGAATTT 1 90 1 AAGTTTAAGA 0.982077 -56 ********** Masking position 5 Map Score: 2.16053 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 44 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0