AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00480_ctra_reg_100.orf -o00480_ctra_100.ace -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 zwf 300 Glucose-6-P Dehyrogenase Motif number 1 AAGAGAGAGCCCACAATACCAAAAAAACGA 1 46 0 CCACAATACC 0.997406 -255 TTAATTTCTTCCAAGATACAACCTAGTATA 1 91 0 CCAAGATACA 0.989774 -210 GACTTTGGCCCCACATTACCAGCCTGTCCT 1 122 1 CCACATTACC 0.993473 -179 CCAAAAATAACCACGATACAGGGAGGACAG 1 145 0 CCACGATACA 0.997406 -156 ********** Masking position 7 Map Score: 7.14259 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 7 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TGTTTTATGAGAGAGAAATCTTTTT 1 6 1 TATGAGAGAG 0.965728 -295 GTTAATTTTTTAAGAGAGAGCCCACAATAC 1 57 0 TAAGAGAGAG 0.941106 -244 AGATACAACCTAGTATAGAGTGTTAATTTT 1 78 0 TAGTATAGAG 0.938551 -223 TCTTGGAAGAAATTAAAGACTTTGGCCCCA 1 105 1 AATTAAAGAC 0.80645 -196 AACCACGATACAGGGAGGACAGGCTGGTAA 1 137 0 CAGGGAGGAC 0.939525 -164 TTGTATAAAGCAGGAAAGAGCTTCCTAGAG 1 193 0 CAGGAAAGAG 0.990412 -108 CAATTTAACAAAGGAAGGACGTCTATCCGA 1 220 1 AAGGAAGGAC 0.974236 -81 AACAAAGTTTTCGGATAGACGTCCTTCCTT 1 230 0 TCGGATAGAC 0.946629 -71 ********** Masking position 9 Map Score: 4.8915 Number of sites scoring better than the average of aligned sites = 482 Number in coding regions = 482 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 AAGATTTCTCTCTCATAAAACA 1 1 0 TCTCTAAACA 0.968354 -300 GAGAGAGAAATCTTTTTAGGCACATATTCGTT 1 19 1 TCTTTTAGCA 0.950435 -282 TTGTGGGCTCTCTCTTAAAAAATTAACACTCT 1 60 1 TCTCTAAAAA 0.908706 -241 CTAGGTTGTATCTTGGAAGAAATTAAAGACTT 1 95 1 TCTTGAAGAA 0.918362 -206 AGAGGTCAAGTCTCCTGTAGCACCAAAAATAA 1 165 0 TCTCTGTACA 0.960807 -136 GCGACCTAAGTCTCATGAGCAATTTCGCGAAG 1 277 1 TCTCTGAGAA 0.989855 -24 **** **** ** Masking position 3 Map Score: 2.97749 Number of sites scoring better than the average of aligned sites = 149 Number in coding regions = 148 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 TAGGCACATATTCGTTTTTTTGGTATTGTG 1 35 1 TTCGTTTTTT 0.968556 -266 GTATAGAGTGTTAATTTTTTAAGAGAGAGC 1 66 0 TTAATTTTTT 0.948577 -235 GCCAAAGTCTTTAATTTCTTCCAAGATACA 1 101 0 TTAATTTCTT 0.9154 -200 CTGTATCGTGGTTATTTTTGGTGCTACAGG 1 154 1 GTTATTTTTG 0.848296 -147 ATAGACGTCCTTCCTTTGTTAAATTGTATA 1 216 0 TTCCTTTGTT 0.947556 -85 ATCCGAAAACTTTGTTTGTGTTGGGTTTGC 1 244 1 TTTGTTTGTG 0.946869 -57 ********** Masking position 5 Map Score: 1.02666 Number of sites scoring better than the average of aligned sites = 314 Number in coding regions = 314 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0