AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00520_ctra_reg_100.orf -o00520_ctra_100.ace -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 glgX 117 Glycogen Hydrolase (debranching) Motif number 1 TCATACAACAAAAGGAAGAGGGTCTCTCTT 1 22 1 AAAGGAAGAG 0.999449 -96 CTTAAACACAAAAGGAAGAGAGACCCTCTT 1 37 0 AAAGGAAGAG 0.999449 -81 CTAACCGAAGAAATGAAGAGAAGAGAGGGG 1 67 0 AAATGAAGAG 0.998498 -51 ********** Masking position 6 Map Score: 9.96121 Number of sites scoring better than the average of aligned sites = 19 Number in coding regions = 19 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TGCTATCATACAACAAAAGGAAGAGGGTCT 1 17 1 CAACAAAAGG 0.975309 -101 AGGGGCTTAAACACAAAAGGAAGAGAGACC 1 42 0 ACACAAAAGG 0.990013 -76 AGAAATGAAGAGAAGAGAGGGGCTTAAACA 1 59 0 AGAAGAGAGG 0.989501 -59 AAAATCTAACCGAAGAAATGAAGAGAAGAG 1 72 0 CGAAGAAATG 0.977421 -46 AAAAACTAGAACAAGTAAGTTTAATAAAAA 1 98 0 ACAAGTAAGT 0.924148 -20 ********** Masking position 3 Map Score: 2.46168 Number of sites scoring better than the average of aligned sites = 315 Number in coding regions = 315 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 AACAAAAGGAAGAGGGTCTCTCTTCCTTTT 1 28 1 AGAGGGTCTC 0.998596 -90 TGAAGAGAAGAGAGGGGCTTAAACACAAAA 1 54 0 AGAGGGGCTT 0.998587 -64 ********** Masking position 3 Map Score: 1.54483 Number of sites scoring better than the average of aligned sites = 11 Number in coding regions = 11 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.59896e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0