AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00940_ctra_reg_100.orf -o00940_ctra_100.ace -a/home/amcguire/genomes/ORF_ctra.txt -z/home/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 ubiA 111 4-hydroxybenzoate octaphenyltransferase Motif number 1 TTATCTGTACGTTGAAACGAACTT 1 5 1 CTGTACGTTG 0.972908 -107 AAGTACGTTGAAGTTCGTTTCAACGTACAG 1 15 0 AAGTTCGTTT 0.994601 -97 TTGCTGAAAAAAGTACGTTGAAGTTCGTTT 1 25 0 AAGTACGTTG 0.99503 -87 TGTAATCAGAAGGAGCTTTTCTTGCTGAAA 1 46 0 AGGAGCTTTT 0.960313 -66 ATTACAATACAAGATCTTTTACACCTATAA 1 70 1 AAGATCTTTT 0.979285 -42 ********** Masking position 8 Map Score: 5.41129 Number of sites scoring better than the average of aligned sites = 111 Number in coding regions = 110 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 TTATCTGTACGTTGAAACGAA 1 2 1 TATCTGTACG 0.986169 -110 TTCTTGCTGAAAAAAGTACGTTGAAGTTCG 1 28 0 AAAAAGTACG 0.94806 -84 CTTGTATTGTAATCAGAAGGAGCTTTTCTT 1 53 0 AATCAGAAGG 0.992105 -59 AATCCCATAATATTCGAAGGGTTT 1 98 1 TATTCGAAGG 0.973424 -14 ********** Masking position 8 Map Score: 0.526624 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 37 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0