AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00072_hinf_reg_100.orf -o00072_hinf_100.ace -a/home/amcguire/genomes/ORF_hinf.txt -z/home/amcguire/genomes/hinf.fna -g0.38 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 HI0774 205 acetate CoA-transferase, alpha subunit Motif number 1 AAACACTATCAAAATAACTTATACCCGCCT 1 23 1 AAAATAACTT 0.934623 -183 TTATACCCGCCTAAGAAAGATGTATTTCTT 1 41 1 CTAAGAAAGA 0.957299 -165 AGAATTTCGTAAAAGAAATACATCTTTCTT 1 53 0 AAAAGAAATA 0.984553 -153 AAAAATAGCAAAAAGAATTTCGTAAAAGAA 1 66 0 AAAAGAATTT 0.902106 -140 GATAGGCAATAAAGGAACTAGATTGATATT 1 96 0 AAAGGAACTA 0.963796 -110 AGAATATCAACAAATAAGTATCTTATATTT 1 156 0 CAAATAAGTA 0.934747 -50 TAACGAGATTAAAAGAAAGAATATCAACAA 1 173 0 AAAAGAAAGA 0.984246 -33 AGAGACCTCCTAATAACGAGATTAAAAGA 1 187 0 CTAATAACGA 0.932339 -19 ********** Masking position 6 Map Score: 8.38781 Number of sites scoring better than the average of aligned sites = 697 Number in coding regions = 561 Number in noncoding regions = 136 Number of orfs with sites within 600 bp upstream = 113 Fraction of orfs with sites within 600 bp upstream = 0.0181497 Motif number 2 TGTTTAAAACACTATCAAAATAACTTATACC 1 17 1 ACTATCAAAT 0.97746 -189 TGATATTAAAAATAGCAAAAAGAATTTCGTA 1 72 0 AATAGCAAAA 0.987872 -134 TGCTATTTTTAATATCAATCTAGTTCCTTTA 1 86 1 AATATCAACT 0.959549 -120 TCCTTTATTGCCTATCAAGGATCATCGCAAG 1 110 1 CCTATCAAGA 0.968173 -96 TATCAAGGATCATCGCAAGAAACATATCCAT 1 122 1 CATCGCAAAA 0.961077 -84 TAAAAGAAAGAATATCAACAAATAAGTATCT 1 163 0 AATATCAAAA 0.989925 -43 ******** ** Masking position 7 Map Score: 5.33865 Number of sites scoring better than the average of aligned sites = 295 Number in coding regions = 242 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 3 AAGGATTGTTTAAAACACTATCAAAATA 1 9 1 TTTAAAACAC 0.878905 -197 TAAAACACTATCAAAATAACTTATACCCGC 1 21 1 TCAAAATAAC 0.921134 -185 TTTTTGCTATTTTTAATATCAATCTAGTTC 1 82 1 TTTTAATATC 0.972666 -124 ACATATCCATTTGAAATATAAGATACTTAT 1 143 1 TTGAAATATA 0.763015 -63 ATATTCTTTCTTTTAATCTCGTTATTAGGA 1 179 1 TTTTAATCTC 0.967221 -27 AGAGACCTCCTAATAACGAGATTAAAA 1 189 0 TCCTAATAAC 0.945389 -17 ********** Masking position 5 Map Score: 0.715286 Number of sites scoring better than the average of aligned sites = 678 Number in coding regions = 569 Number in noncoding regions = 109 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 4 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0