AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00410_hinf_reg_100.orf -o00410_hinf_100.ace -a/home/amcguire/genomes/ORF_hinf.txt -z/home/amcguire/genomes/hinf.fna -g0.38 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 HI0675 110 aminoacyl-histidine dipeptidase (pepD) Motif number 1 AATTTAAACTAAGGTGCAATT 1 2 0 AAGGTGCAAT 0.989382 -109 GTTTAAATTTATCGAGAAATAAAAAATTGC 1 23 1 ATCGAGAAAT 0.986858 -88 GCGTAAGGATAACCCGAAATGGCGTTTTAT 1 51 1 AACCCGAAAT 0.985799 -60 ACTGAAAATATTGACGAAATAATAGCATAA 1 77 0 TTGACGAAAT 0.936086 -34 TTTCAGTAAAAAGGAGCAATT 1 100 1 AAGGAGCAAT 0.993293 -11 ********** Masking position 8 Map Score: 5.33813 Number of sites scoring better than the average of aligned sites = 389 Number in coding regions = 341 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 2 AATTGCACCTTAGTTTAAATTTAT 1 5 1 GCACCTTAGT 0.963301 -106 TTATCCTTACGCAATTTTTTATTTCTCGAT 1 33 0 GCAATTTTTT 0.993765 -78 GGCGTTTTATGCTATTATTTCGTCAATATT 1 71 1 GCTATTATTT 0.972185 -40 TATTATTTCGTCAATATTTTCAGTAAAAAG 1 83 1 TCAATATTTT 0.903679 -28 AATTGCTCCTTTTTACTGAAAATA 1 97 0 GCTCCTTTTT 0.992593 -14 ********** Masking position 10 Map Score: 4.60684 Number of sites scoring better than the average of aligned sites = 909 Number in coding regions = 714 Number in noncoding regions = 195 Number of orfs with sites within 600 bp upstream = 165 Fraction of orfs with sites within 600 bp upstream = 0.0265018 Motif number 3 ATTTAAACTAAGGTGCAATT 1 1 0 AGGTGCAATT 0.970803 -110 CGGGTTATCCTTACGCAATTTTTTATTTCT 1 37 0 TTACGCAATT 0.992058 -74 AAATGGCGTTTTATGCTATTATTTCGTCAA 1 67 1 TTATGCTATT 0.988355 -44 ********** Masking position 8 Map Score: 0.922957 Number of sites scoring better than the average of aligned sites = 136 Number in coding regions = 125 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0