AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00071_hpyl_reg_100.orf -o00071_hpyl_100.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 HP0690 281 acetyl coenzyme A acetyltransferase (thiolase) (fadA) Motif number 1 GGCAAAGACTGCTTAGAAAGAAATTTTTTAAA 1 35 1 GCTTAGAAAA 0.883097 -247 AGAAACATGAGCCTAAAGTGCATATCTGCTTG 1 74 1 GCCTAAAGCA 0.956416 -208 TTGAGTGGGGATCTAAAATCAAGCAGATATGC 1 93 0 ATCTAAAAAA 0.967093 -189 TTAGATCCCCACTCAAAGCTATATTGTGCAAT 1 109 1 ACTCAAAGAT 0.833216 -173 ATCGCCCTCAATCCAAAACAAAACCTAAAATA 1 187 1 ATCCAAAAAA 0.943317 -95 CCAAAACAAAACCTAAAATAAAATCCAACCTG 1 199 1 ACCTAAAAAA 0.992277 -83 GGTGTCAATCACCTAAAAGTGATACTATGAAT 1 235 1 ACCTAAAAGA 0.975331 -47 TAATAAATCAACTTAAAGGCAAAGAC 1 266 1 ACTTAAAGAA 0.980091 -16 ******** ** Masking position 7 Map Score: 5.31625 Number of sites scoring better than the average of aligned sites = 675 Number in coding regions = 584 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 2 CTTATCGTTCAATGATTATTGCACAATATA 1 128 0 AATGATTATT 0.781024 -154 TTTTTCACAAAAATATTATTCTTATCGTTC 1 148 0 AAATATTATT 0.855056 -134 AGGGCGATCCGTTTATTTTTTTCACAAAAA 1 165 0 GTTTATTTTT 0.913857 -117 CTTTAAGTTGATTTATTATTCATAGTATCA 1 254 0 ATTTATTATT 0.957851 -28 ********** Masking position 5 Map Score: 0.156661 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 60 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0