AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00900_hpyl_reg_300.orf -o00900_hpyl_300.ace -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -0.39 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.38 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 HP0925 155 recombinational DNA repair protein (recR) Motif number 1 CACTTCCATTTAAACGCTTCATTAAGCGCT 1 44 1 TAAACGCTTC 0.901219 -112 AACGCTTCATTAAGCGCTTTTTCATATTAT 1 56 1 TAAGCGCTTT 0.517447 -100 TGTTTTTTAAAAGGGGGTTTAATTAAATAA 1 82 0 AAGGGGGTTT 0.966059 -74 AAAGCCACTAAAAGGGCTTTTATTGTTTTT 1 105 0 AAAGGGCTTT 0.533981 -51 AAAGCCCTTTTAGTGGCTTTCAAGTCAAGT 1 115 1 TAGTGGCTTT 0.989077 -41 ********** Masking position 8 Map Score: 7.17845 Number of sites scoring better than the average of aligned sites = 665 Number in coding regions = 606 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 2 ATGTGCTATCTCAATTTTAAGGAATAAC 1 9 0 TCAATTTTAA 0.981791 -147 TTATAACACTTCCATTTAAACGCTTCATTA 1 38 1 TCCATTTAAA 0.988651 -118 TTAATTAAACCCCCTTTTAAAAAACAATAA 1 86 1 CCCCTTTTAA 0.98751 -70 AACAATAAAAGCCCTTTTAGTGGCTTTCAA 1 108 1 GCCCTTTTAG 0.988422 -48 GGCTTTCAAGTCAAGTTAAGTTTGATATAC 1 129 1 TCAAGTTAAG 0.949489 -27 ********** Masking position 6 Map Score: 4.13955 Number of sites scoring better than the average of aligned sites = 563 Number in coding regions = 483 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 3 GTTATTCCTTAAAATTGAGATA 1 3 1 TATTCCTTAA 0.984156 -153 CGCTTTTTCATATTATTTAATTAAACCCCC 1 70 1 TATTATTTAA 0.980294 -86 GGGCTTTTATTGTTTTTTAAAAGGGGGTTT 1 92 0 TGTTTTTTAA 0.976691 -64 ********** Masking position 9 Map Score: 0.651067 Number of sites scoring better than the average of aligned sites = 217 Number in coding regions = 156 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 4 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0