AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00290_mgen_reg_100.orf -o00290_mgen_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.32 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.32 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: MG277 42 conserved hypothetical protein Input sequences: #1 MG267 33 conserved hypothetical protein #2 MG268 150 conserved hypothetical protein #3 MG274 27 pyruvate dehydrogenase component E1, subunit alpha (pdhA) #4 MG275 82 NADH oxidase (nox) #5 MG335.1 58 M. genitalium predicted coding region MG335.1 #6 MG345 43 isoleucyl-tRNA synthetase (ileS) Motif number 1 CTTTATAATTGAAATAACTTA 1 2 1 TTTATAATTG 0.956321 -32 GATTTAAATAATTGTTAGAATTTA 2 5 1 TAAATAATTG 0.910746 -146 TGGTTTTTTATTAAAAATAAACCTTAACCC 2 110 1 TTAAAAATAA 0.886944 -41 ACCCAACATATTAAAAAGTGTTTAT 2 136 1 TTAAAAAGTG 0.949942 -15 TCTATGCTAATTTAAAACTAAG 3 3 0 TTTAAAACTA 0.92417 -25 GATTCGATCTTTTAAAATTAAGCTTTTG 4 9 0 TTTAAAATTA 0.981183 -74 TTAAATAGCTTAAAAAATTACTGCAGCTAA 4 58 1 TAAAAAATTA 0.959743 -25 TTAAAAGTCTTATAAAATTAAATAATCGAA 5 14 0 TATAAAATTA 0.954031 -45 AATTAAACATTTTAAAAGTCTTATAAAATT 5 25 0 TTTAAAAGTC 0.856266 -34 AGCTATATATTAATAATTAAACATTTTAA 5 40 0 TTAATAATTA 0.967177 -19 AGTAATTTTATTAATATTTATCTAACTTAC 6 16 0 TTAATATTTA 0.695644 -28 ********** Masking position 6 Map Score: 15.2841 Number of sites scoring better than the average of aligned sites = 345 Number in coding regions = 296 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 TTTATAATTGAAATAACTTACTGAAAACTAC 1 12 1 AAATACTTAC 0.96154 -22 TAAATTCTAACAATTATTTAAATC 2 4 0 CAATTTTTAA 0.73902 -147 TTTATTAAAAATAAACCTTAACCCAACATAT 2 116 1 ATAAACTTAA 0.920815 -35 AACCTTAACCCAACATATTAAAAAGTGTTTA 2 129 1 CAACAATTAA 0.923592 -22 CAAAAGCTTAATTTTAAAAGA 4 1 1 CAAAACTTAA 0.96626 -82 AATTATCCTTAAATAGCTTAAAAAATTACTG 4 50 1 AAATACTTAA 0.980824 -33 ATTAATAATTAAACATTTTAAAAGTCTTATA 5 30 0 AAACATTTAA 0.903737 -29 AGCTATATATTAATAATTAAACA 5 46 0 CTATAATTAA 0.904022 -13 ATTAATATTTATCTAACTTACATCTG 6 6 0 ATCTACTTAC 0.753949 -38 ***** ***** Masking position 8 Map Score: 5.73368 Number of sites scoring better than the average of aligned sites = 305 Number in coding regions = 271 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 TAGAATTTAGAACCATCACATCATTAGAGT 2 26 1 AACCATCACA 0.996426 -125 TTTAATAAAAAACCATCACACTCACTGACA 2 95 0 AACCATCACA 0.996426 -56 ATAAACCTTAACCCAACATATTAAAAAGTG 2 126 1 ACCCAACATA 0.979898 -25 ********** Masking position 5 Map Score: 2.3451 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 4 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 CTTTATAATTGAAATAACTTACTGAA 1 7 1 AATTGAAATA 0.888472 -27 ACATCATTAGAGTCGAATCATGTCAGGCCA 2 43 1 AGTCGAATCA 0.986426 -108 AATTTTAAAAGATCGAATCACTACTGCACA 4 20 1 GATCGAATCA 0.986427 -63 AAAATTAAATAATCGAATTA 5 1 0 AATCGAATTA 0.987668 -58 ********** Masking position 6 Map Score: 1.7559 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 5 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 CAGAAATGGAGCAGCATTAAGACTTGTCAG 2 71 1 GCAGCATTAA 0.988776 -80 GATAATTTGTGCAGTAGTGATTCGATCTTT 4 27 0 GCAGTAGTGA 0.984589 -56 ATATCTTAGCTGCAGTAATTTTTTAAGC 4 65 0 GCTGCAGTAA 0.992721 -18 ********** Masking position 6 Map Score: 0.730148 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 4 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0