AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00430_mjan_reg_300.orf -o00430_mjan_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MJ0050 109 group II decarboxylase Motif number 1 AACATTTATTTGAGGTTTAATT 1 3 0 TGAGGTTTAA 0.979079 -107 CAAATAAATGTTTAGTATATTGTATTATAT 1 21 1 TTTAGTATAT 0.974496 -89 TTTAGTATATTGTATTATATTTATACCTAA 1 31 1 TGTATTATAT 0.940213 -79 TAATGCGTTCTTAGGTATAAATATAATACA 1 41 0 TTAGGTATAA 0.961165 -69 AACATCATGATTAAATTTATAAGTATTTAA 1 68 0 TTAAATTTAT 0.743976 -42 AATTTAATCATGATGTTTATCAACTAAAAA 1 81 1 TGATGTTTAT 0.976294 -29 CCTTTAATTTTTTTAGTTGATAA 1 97 0 TTAATTTTTT 0.888931 -13 ********** Masking position 6 Map Score: 7.75489 Number of sites scoring better than the average of aligned sites = 1278 Number in coding regions = 1035 Number in noncoding regions = 243 Number of orfs with sites within 600 bp upstream = 222 Fraction of orfs with sites within 600 bp upstream = 0.0356569 Motif number 2 ATACTAAACATTTATTTGAGGTTTAATT 1 9 0 TTTATTTGAG 0.967106 -101 CAAATAAATGTTTAGTATATTGTATTATAT 1 21 1 TTTAGTATAT 0.977301 -89 TTTAGTATATTGTATTATATTTATACCTAA 1 31 1 TGTATTATAT 0.970766 -79 TAAATTTATAAGTATTTAATGCGTTCTTAG 1 57 0 AGTATTTAAT 0.85227 -53 AACATCATGATTAAATTTATAAGTATTTAA 1 68 0 TTAAATTTAT 0.804002 -42 CTTTAATTTTTTTAGTTGATAAACATCATG 1 89 0 TTTAGTTGAT 0.988172 -21 ********** Masking position 6 Map Score: 4.65994 Number of sites scoring better than the average of aligned sites = 1087 Number in coding regions = 851 Number in noncoding regions = 236 Number of orfs with sites within 600 bp upstream = 222 Fraction of orfs with sites within 600 bp upstream = 0.0356569 Motif number 3 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0