AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00472_mjan_reg_100.orf -o00472_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MJ1146 66 glyceraldehyde 3-phosphate dehydrogenase #2 MJ1530 178 ribosomal protein S18 alanine acetyltransferase Motif number 1 TCCTACAAAAATTTCAAATGGTGAATCT 1 49 1 ATTTAAATGT 0.971787 -18 AACACCCCCTTTATGAAAGCGTTCAAAATTCA 2 11 0 TTATAAAGGT 0.976523 -168 TTTTAAAACATTTTGAAATACTAAGGACCAAT 2 44 0 TTTTAAATCT 0.994699 -135 TTTCAAAATGTTTTAAAAGACTCTATAAAAAG 2 58 1 TTTTAAAGCT 0.995606 -121 TTTTAGTATTATTTTAAATTCTTTTTATAGAG 2 78 0 ATTTAAATCT 0.987897 -101 GTTGTGTAATTTATTAAATTCTATTTTAATTT 2 107 0 TTATAAATCT 0.987898 -72 TGATTAAAATTATTCAAAGGCTTTACTAAAGG 2 145 1 TATTAAAGCT 0.979185 -34 **** **** ** Masking position 6 Map Score: 13.1789 Number of sites scoring better than the average of aligned sites = 297 Number in coding regions = 250 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 2 TTGGCAATATATATTTTTATAAT 1 4 0 ATATTTTTAT 0.94588 -63 ATTGCCAAAGTAATTATTATTAATCCTACA 1 26 1 TAATTATTAT 0.889921 -41 TCACCATTTGAAATTTTTGTAGGATTAATA 1 43 0 AAATTTTTGT 0.965005 -24 TTATTTTAAATTCTTTTTATAGAGTCTTTT 2 72 0 TTCTTTTTAT 0.940936 -107 AATTTTAGTATTATTTTAAATTCTTTTTAT 2 82 0 TTATTTTAAA 0.834484 -97 AATTCTATTTTAATTTTAGTATTATTTTAA 2 93 0 TAATTTTAGT 0.977895 -86 AGCCTTTGAATAATTTTAATCAATGAATGT 2 137 0 TAATTTTAAT 0.978324 -42 GTTCTCACTTAACCTTTAGTAAAGCCTTTG 2 159 0 AACCTTTAGT 0.805735 -20 ********** Masking position 5 Map Score: 7.33654 Number of sites scoring better than the average of aligned sites = 1390 Number in coding regions = 901 Number in noncoding regions = 489 Number of orfs with sites within 600 bp upstream = 392 Fraction of orfs with sites within 600 bp upstream = 0.0629618 Motif number 3 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0