AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00900_mjan_reg_100.orf -o00900_mjan_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.31 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.31 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 MJ0861 131 conserved hypothetical protein Motif number 1 ACAGTATTAACAATACTGTT 1 1 0 CAATACTGTT 0.953011 -131 ACAGTATTGTTAATACTGTTATCCCATTTA 1 12 1 TAATACTGTT 0.967884 -120 GTTATCCCATTTATGATTTTTATTTTTATC 1 29 1 TTATGATTTT 0.966344 -103 TAATTATTTTAAATAAATTTACAGCCTAAC 1 65 0 AAATAAATTT 0.829164 -67 TATAAATATTTAATTATTTTAAATAAATTT 1 75 0 TAATTATTTT 0.948937 -57 ATTTTAATGTTTATAAATATTTAATTATTT 1 86 0 TTATAAATAT 0.859981 -46 CTTTAATTTTTTATAATTTTAATGTTTATA 1 101 0 TTATAATTTT 0.989453 -31 CTCTCACATCCTTTAATTTTTTATAATTTT 1 111 0 CTTTAATTTT 0.918938 -21 ********** Masking position 4 Map Score: 9.15348 Number of sites scoring better than the average of aligned sites = 1423 Number in coding regions = 1020 Number in noncoding regions = 403 Number of orfs with sites within 600 bp upstream = 356 Fraction of orfs with sites within 600 bp upstream = 0.0571796 Motif number 2 CATCTAAGATAAAAATAAAAATCATAAATG 1 36 0 AAAAATAAAA 0.97308 -96 ATTTACAGCCTAACATCTAAGATAAAAATA 1 49 0 TAACATCTAA 0.945629 -83 TAATGTTTATAAATATTTAATTATTTTAAA 1 82 0 AAATATTTAA 0.971718 -50 AAATATTTATAAACATTAAAATTATAAAAA 1 94 1 AAACATTAAA 0.992984 -38 TAAAATTATAAAAAATTAAAGGATGTGAGA 1 110 1 AAAAATTAAA 0.988997 -22 ********** Masking position 5 Map Score: 7.24233 Number of sites scoring better than the average of aligned sites = 801 Number in coding regions = 575 Number in noncoding regions = 226 Number of orfs with sites within 600 bp upstream = 205 Fraction of orfs with sites within 600 bp upstream = 0.0329264 Motif number 3 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0