AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00630_pyro_reg_300.orf -o00630_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 PH0893 52 161aa long hypothetical protein #2 PH0935 40 246aa long hypothetical protein #3 PH0938 107 238aa long hypothetical protein #4 PH0939 27 430aa long hypothetical ribulose 1,5-bisphosphate carboxylase large subunit #5 PH1277 45 360aa long hypothetical malate dehydrogenase #6 PH1353 66 679aa long hypothetical formate dehydrogenase #7 PH1354 28 196aa long hypothetical protein #8 PH1433 59 118aa long hypothetical protein #9 PH1437 45 427aa long hypothetical NADH-ubiquinone oxidoreductase subunit #10 PH1683 300 272aa long hypothetical L(+)-tartrate dehydratase Motif number 1 CTTTATTCCTGGGATATAAACCTTTAGCTT 3 13 0 GGGATATAAA 0.943495 -95 TATTCCCTTAGGAGTTTAAATCT 4 4 0 GGAGTTTAAA 0.837719 -24 TAAACTCCTAAGGGAATATACT 4 16 1 AGGGAATATA 0.844717 -12 ATTAAAGGTTAGAGAATAAAGCCTTAA 5 8 0 AGAGAATAAA 0.945221 -38 AATCCCCATGAAGAATTAAAGGTTAGAGAA 5 22 0 AAGAATTAAA 0.678782 -24 ATTCTTCATGGGGATTTGAA 5 36 1 GGGATTTGAA 0.807827 -10 CTCCAAAAAGAGGAAAGAAA 7 1 0 AGGAAAGAAA 0.957745 -28 TCTCTCCTCAAGAAATTAAAGACATTGCAA 10 91 1 AGAAATTAAA 0.915399 -210 GACATTGCAAAGGGATTAAACCTCAGTATC 10 111 1 AGGGATTAAA 0.971523 -190 TCAAAATCCTAGGAAAGGAAGAGATAAGGA 10 139 1 AGGAAAGGAA 0.887073 -162 CGAAATTGAGGGTGAAGAAAGGAAAATAAA 10 188 1 GGTGAAGAAA 0.772541 -113 GGTGAAGAAAGGAAAATAAAAGCTTTTATG 10 198 1 GGAAAATAAA 0.945221 -103 ********** Masking position 10 Map Score: 9.44562 Number of sites scoring better than the average of aligned sites = 1397 Number in coding regions = 1267 Number in noncoding regions = 130 Number of orfs with sites within 600 bp upstream = 132 Fraction of orfs with sites within 600 bp upstream = 0.0212014 Motif number 2 AAGGTTTATATCCCAGGAATAAAGTTTCCT 3 19 1 TCCCAGGAAT 0.923319 -89 GGAGGCACTATCTCAAGGGA 3 98 1 TCTCAAGGGA 0.526556 -10 AGTATATTCCCTTAGGAGTTTAAATCT 4 9 0 CCTTAGGAGT 0.923585 -19 TTCAAATCCCCATGAAGAATTAAAGGT 5 29 0 CCCCATGAAG 0.79453 -17 CTGCAAGAAATCTCTGGGATATTACAAGTT 8 19 1 TCTCTGGGAT 0.781117 -41 ACGTCATGACCCTTATGGGAG 8 49 1 CCTTATGGGA 0.895588 -11 TACCTCCCCTCCTCAGGAGATAGGGATGAC 9 25 0 CCTCAGGAGA 0.89516 -21 AGTTATCGAACCTTATGCAAATCCATGAGA 10 42 1 CCTTATGCAA 0.898543 -259 TAATAATGGCTCTCATGGATTTGCATAAGG 10 52 0 TCTCATGGAT 0.900453 -249 TTCTATCTCTCCTCAAGAAATTAAAGACAT 10 86 1 CCTCAAGAAA 0.926716 -215 GAGGTTTAATCCCTTTGCAATGTCTTTAAT 10 105 0 CCCTTTGCAA 0.620185 -196 AGTATCAAAATCCTAGGAAAGGAAGAGATA 10 135 1 TCCTAGGAAA 0.902729 -166 ********** Masking position 2 Map Score: 7.17369 Number of sites scoring better than the average of aligned sites = 1684 Number in coding regions = 1581 Number in noncoding regions = 103 Number of orfs with sites within 600 bp upstream = 108 Fraction of orfs with sites within 600 bp upstream = 0.0173466 Motif number 3 ATTTCCCAATTTTGTCCATAACTTTTGG 1 5 1 CCATTTGCCA 0.99257 -48 CCACAGTGAGCACAGTTTAGATAACAATACTCAC 3 65 0 CCATTTGTAA 0.982708 -43 GTTCCCCATTTTTGGTCATATTTATGTA 6 5 1 CCATTTGTCA 0.996639 -62 AATTCATTTTTGATCTACAAAGGTTT 10 3 1 TCATTTGTCT 0.975406 -298 TTTCTTCACCCTCAATTTCGATCTTCCACAACGT 10 174 0 CCATTTGTCT 0.995192 -127 * ** *** * *** Masking position 7 Map Score: 3.42241 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 10 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 TCCCAATTTTGTCCATAACTTTTGGTTTTA 1 14 1 GTCCATAACT 0.938794 -39 ACAGGTGAGTATTGTTATCTAAACTGTGCT 3 61 1 ATTGTTATCT 0.896013 -47 AATGCAGGTCATCCCTATCTCCTGAGGAGG 9 18 1 ATCCCTATCT 0.966237 -28 TTGCATAAGGTTCGATAACTTATTAAAACC 10 32 0 TTCGATAACT 0.843972 -269 CAACGTGATTATCCTTATCTCTTCCTTTCC 10 150 0 ATCCTTATCT 0.979915 -151 CGCTCTTGCCATTCTTAACTTTTTCATAAA 10 222 0 ATTCTTAACT 0.942808 -79 ********** Masking position 6 Map Score: 1.74426 Number of sites scoring better than the average of aligned sites = 289 Number in coding regions = 275 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 5 TTGGTTTTAAATATGAAAATGTTTTTAT 1 35 1 ATATGAAAAT 0.948747 -18 TTGGTCATATTTATGTAAATTACTTGCGAA 6 22 1 TTATGTAAAT 0.964848 -45 TTATCGAACCTTATGCAAATCCATGAGAGC 10 44 1 TTATGCAAAT 0.945544 -257 ATAAAAGCTTTTATGAAAAAGTTAAGAATG 10 213 1 TTATGAAAAA 0.948747 -88 ********** Masking position 4 Map Score: 0.998128 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 13 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 ********** No masking Map Score: -2.95996e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.95996e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.95996e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0