AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00220_tpal_reg_100.orf -o00220_tpal_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 TP0350 213 glutamate-5-semialdehyde dehydrogenase (proA) #2 TP0797 50 1-pyrroline-5-carboxylate reductase (proC) #3 TP0798 32 methionyl-tRNA synthetase (metG) Motif number 1 AGGCAAGATACTCACGGCAAGGGCAGTTTC 1 28 1 CTCACGGCAA 0.990873 -186 CTGTCAAGGGCACACGGCACAGAAACTGCC 1 49 0 CACACGGCAC 0.997687 -165 CCCAACACCTCGCCCGGCTTATCCCCTATA 1 88 0 CGCCCGGCTT 0.983761 -126 GGACCACACGCTCCCAACACCTCGCCCGGC 1 100 0 CTCCCAACAC 0.972426 -114 CCTCTTTTACCGCACAGCACCGCGCAAGAG 1 140 0 CGCACAGCAC 0.997655 -74 GAATATTCACAGAGCATTTGGTTTTCC 2 8 1 CACAGAGCAT 0.965499 -43 ********** Masking position 3 Map Score: 8.85397 Number of sites scoring better than the average of aligned sites = 403 Number in coding regions = 363 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 TGCCTGTGCTAGCATGCCGCGC 1 3 0 AGCATGCCGC 0.914499 -211 GTGAGTATCTTGCCTGTGCTAGCATGCCGC 1 13 0 TGCCTGTGCT 0.97777 -201 GCACAGAAACTGCCCTTGCCGTGAGTATCT 1 33 0 TGCCCTTGCC 0.988766 -181 CTGTGCCGTGTGCCCTTGACAGAATCGCCG 1 57 1 TGCCCTTGAC 0.945802 -157 AGGTGTTGGGAGCGTGTGGTCCACTTCTTG 1 108 1 AGCGTGTGGT 0.959256 -106 ATATTCACAGAGCATTTGGTTTTCCGTGTC 2 13 1 AGCATTTGGT 0.949965 -38 GCTGCGCTCCCCCTATCCGACA 2 39 0 TGCGCTCCCC 0.9692 -12 AGCGTTTCCTACTCTGATTT 3 23 0 AGCGTTTCCT 0.971849 -10 ********** Masking position 3 Map Score: 7.01705 Number of sites scoring better than the average of aligned sites = 1024 Number in coding regions = 961 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 3 AATCGCCGTTATAGGGGATAAGCCGGGCGA 1 79 1 ATAGGGGATA 0.956145 -135 GCACCGCGCAAGAGGGCAAGAAGTGGACCA 1 124 0 AGAGGGCAAG 0.987565 -90 GTGCGGTAAAAGAGGGGGCGTCGCGTTCGA 1 155 1 AGAGGGGGCG 0.997302 -59 TCCGTGTCGGATAGGGGGAGCGCAGC 2 35 1 ATAGGGGGAG 0.996437 -16 TGTTTAAATCAGAGTAGGAAACGCT 3 18 1 AGAGTAGGAA 0.911261 -15 ********** Masking position 3 Map Score: 3.97627 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 213 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 4 ACAGAAACTGCCCTTGCCGTGAGTATCTTG 1 31 0 CCCTTGCCGT 0.960021 -183 AAGGGCAGTTTCTGTGCCGTGTGCCCTTGA 1 46 1 TCTGTGCCGT 0.981865 -168 CCCTATAACGGCGATTCTGTCAAGGGCACA 1 65 0 GCGATTCTGT 0.902391 -149 TAAGCCGGGCGAGGTGTTGGGAGCGTGTGG 1 97 1 GAGGTGTTGG 0.931148 -117 GCCCTCTTGCGCGGTGCTGTGCGGTAAAAG 1 137 1 GCGGTGCTGT 0.996582 -77 CATTTGGTTTTCCGTGTCGGATAGGGGGAG 2 25 1 TCCGTGTCGG 0.97642 -26 ********** Masking position 5 Map Score: 1.73105 Number of sites scoring better than the average of aligned sites = 924 Number in coding regions = 849 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 5 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.38628e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0