AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00380_tpal_reg_100.orf -o00380_tpal_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 TP0632 104 tryptophanyl-tRNA synthetase (trsA) Motif number 1 TCTATATCACGGGTGCGTGTCCGTC 1 6 0 GGGTGCGTGT 0.961141 -99 TATAGAGGAGGGCTGCGCGGTCGGCGCACG 1 30 1 GGCTGCGCGG 0.993294 -75 GCGCAGGAACACGTGCGCCGACCGCGCAGC 1 41 0 ACGTGCGCCG 0.914661 -64 GCGCACGTGTTCCTGCGCCTGCACTCTTGA 1 53 1 TCCTGCGCCT 0.986851 -52 CTGTAAATCAAGGTCCGTCCAGTATTCAAG 1 78 0 AGGTCCGTCC 0.978254 -27 ********** Masking position 4 Map Score: 7.01978 Number of sites scoring better than the average of aligned sites = 818 Number in coding regions = 755 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 60 Fraction of orfs with sites within 600 bp upstream = 0.00963701 Motif number 2 ACCGCGCAGCCCTCCTCTATATCACGGGTG 1 21 0 CCTCCTCTAT 0.997061 -84 TGTTCCTGCGCCTGCACTCTTGAATACTGG 1 60 1 CCTGCACTCT 0.996345 -45 AATCAAGGTCCGTCCAGTATTCAAGAGTGC 1 73 0 CGTCCAGTAT 0.994363 -32 ********** Masking position 3 Map Score: 2.30435 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 25 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 AGCCCTCCTCTATATCACGGGTGCGTGTCC 1 14 0 TATATCACGG 0.997201 -91 GGGGAGACTGTAAATCAAGGTCCGTCCAGT 1 85 0 TAAATCAAGG 0.995858 -20 ********** Masking position 5 Map Score: 1.0373 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 0 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0